NADPH oxidases (NOX) are important sources of reactive oxygen species (ROS) in skeletal muscle, being involved in excitation-contraction coupling. Thus, we aimed to investigate if NOX activity and expression in skeletal muscle are fiber type specific and the possible contribution of this difference to cellular oxidative stress. Oxygen consumption rate, NOX activity and mRNA levels, and the activity of catalase (CAT), glutathione peroxidase (GPX), and superoxide dismutase (SOD), as well as the reactive protein thiol levels, were measured in the soleus (SOL), red gastrocnemius (RG), and white gastrocnemius (WG) muscles of rats. RG showed higher oxygen consumption flow than SOL and WG, while SOL had higher oxygen consumption than WG. SOL showed higher NOX activity, as well as NOX2 and NOX4 mRNA levels, antioxidant enzymatic activities, and reactive protein thiol contents when compared to WG and RG. NOX activity and NOX4 mRNA levels as well as antioxidant enzymatic activities were higher in RG than in WG. Physical exercise increased NOX activity in SOL and RG, specifically NOX2 mRNA levels in RG and NOX4 mRNA levels in SOL. In conclusion, we demonstrated that NOX activity and expression differ according to the skeletal muscle fiber type, as well as antioxidant defense.
Skeletal muscle fibers are constantly generating ROS in different subcellular locations, due to physiological and pathophysiological stimuli [
The NOX family is composed of seven members, NOX1 to NOX5 and DUOX1 and DUOX2, which are differentially expressed among tissues. The main function of NOX enzymes is ROS production, and NOX1, NOX3, and NOX5 produce superoxide (
Muscle fibers can be grouped into three major categories: slow-twitch type I fibers with high capillary density and high oxidative capacity adapted to endurance exercise, fast-twitch fibers type IIb, which have low capillary density and low oxidative capacity ideal for sprint and anaerobic performance, and type IIa fibers that show intermediate characteristics [
Adult male Wistar rats weighing 250–300 g were maintained in an animal house with controlled lighting (12 h light-dark cycle) and temperature (23-24°C). This investigation conforms to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication number 85-23, revised 1996) and was approved by the Institutional Committee for Evaluation of Animal Use in Research (Comissão de Ética com o Uso de Animais (CEUA) em Experimentação Científica da Universidade Estadual do Ceará, number 10724359-8-5).
After acclimatization, animals underwent a test to determine the maximum speed race—Maximum Speed Test (MST). The test started at a speed of 0.3 km/h, and every 3 minutes 0.2 km/h of speed was added, increasing the velocity until animal exhaustion [
The training speed used was approximately 60% of Maximum Speed Testing (maximal lactate steady state). There were five training sessions per week. The animals trained 30 minutes daily during the first week, 1 hour daily in the second week, and 2 hours daily in the third week. After the experimental period, the animals were euthanized by decapitation. Rat tissues were dissected out, snap-frozen in liquid nitrogen, and then kept at −80°C until processing.
Mitochondria respiration was studied
Skeletal muscle fibers (1.5–4.0 mg of muscle) were dried on filter paper, weighed, and placed on a high-resolution respirometer instrument chamber (Oxygraph-2k; Oroboros) with 2 mL of MIR05 solution at 37°C and left for 10 min for acclimatization. The substrate addition protocol to assess O2 flux was performed sequentially as follows: pyruvate (5 mM) and malate (5 mM), ADP (3 mM), cytochrome c (10
Muscle samples were homogenized in lysis buffer (50 mM sodium phosphate, 10% glycerol, 1% octal-phenol ethoxylate, 10 mM sodium orthovanadate, 10 mM sodium fluoride, and 10 mM sodium pyrophosphate, pH 7.4) and supplemented with protease inhibitor mixture (P8340; Sigma). After 30 min on ice, the tissue lysates were centrifuged at 13,000 ×g for 20 min at 4°C, and the resulting supernatants were collected. A reaction mixture containing 20 mM Tris·HCl, pH 8.0, 0.42 mM acetyl-coenzyme A, 0.1 mM 5′,5′-dithiobis(2-nitrobenzoic acid) (DTNB), and 5
NOX activity was quantified in muscle microsomal fractions by the Amplex red/horseradish peroxidase assay, which detects the accumulation of a fluorescent oxidized product. In order to obtain the microsomal fraction, the homogenates from muscle samples were centrifuged at 3,000 ×g for 15 min at 4°C. Then, the supernatant was centrifuged at 100,000 ×g for 35 min at 4°C, and the pellet was suspended in 0.5 mL 50 mM sodium phosphate buffer, pH 7.2, containing 0.25 M sucrose, 2 mM MgCl2, 5 mg/mL aprotinin, and 34.8 mg/mL phenylmethanesulfonyl fluoride (PMSF) and stored at –80°C until H2O2 generation measurements. The microsomal fraction was incubated in 150 mM sodium phosphate buffer (pH 7.4), containing SOD (100 U/mL; Sigma, USA), horseradish peroxidase (0.5 U/mL; Roche, Indianapolis, IN), Amplex red (50
The specific enzymatic activity was expressed as nmol H2O2 per hour and milligram of protein (nmol·h−1·mg−1). Protein concentration was determined by the Bradford assay [
Muscle samples were homogenized in 5 mM Tris-HCl buffer (pH 7.4), containing 0.9% NaCl (w/v) and 1 mM EDTA, followed by centrifugation at 750 ×g for 10 minutes at 4°C. The supernatant aliquots were stored at −70°C. Catalase activity was assayed following the method of Aebi and was expressed as units per milligram of protein (U·mg−1) [
Muscle samples were homogenized in 5 mM Tris-HCl buffer (pH 7.4), containing 0.9% NaCl (w/v) and 1 mM EDTA, followed by centrifugation at 750 ×g for 10 minutes at 4°C. The redox status of the studied tissues was determined by the measurement of reactive protein thiols immediately after sample homogenization. Total reduced thiols were determined using DTNB. Thiol residues react with DTNB, cleaving the disulfide bond to give 2-nitro-5-thiobenzoate (NTB−), which ionizes to the NTB2− dianion in water at neutral and alkaline pH. NTB2− was quantified in a spectrophotometer (Hitachi U-3300) by measuring the absorbance at 412 nm and was expressed as nmol of reduced DTNB/mg protein [
Total RNA was extracted using RNeasy Mini kit (Qiagen, Venlo, Netherlands) and 2
Primers sequence using in RT PCR.
Gene | Forward | Reverse |
---|---|---|
Catalase | 5′ CAAGCTGGTTAATGCGAATGG 3′ | 5′ TTGAAAAGATCTCGGAGGCC 3′ |
GPX1 | 5′ AATCAGTTCGGACATCAGGAG 3′ | 5′ GAAGGTAAAGAGCGGGTGAG 3′ |
GPX2 | 5′ TCCCTTGCAACCAGTTCG 3′ | 5′ TCTGCCCATTGACATCACAC 3′ |
GPX3 | 5′ CAGCTACTGAGGTCTGACAG 3′ | 5′ ACTAGGCAGGATCTCCGAG 3′ |
SOD1 | 5′ TGTGTCCATTGAAGATCGTGTG 3′ | 5′ CTTCCAGCATTTCCAGTCTTTG 3′ |
SOD2 | 5′ GGACAAACCTGAGCCCTAAG 3′ | 5′ CAAAAGACCCAAAGTCACGC 3′ |
SOD3 | 5′ GACCTGGAGATCTGGATGGA 3′ | 5′ GTGGTTGGAGGTGTTGTGCT 3′ |
NOX2 | 5′ CAATTCACACCATTGCACATC 3′ | 5′ CGAGTCACAGCCACATACAG 3′ |
NOX4 | 5′ TCCATCAAGCCAAGATTCTGAG 3′ | 5′ GGTTTCCAGTCATCCAGTAGAG 3′ |
DUOX1 | 5′ GATACCCAAAGCTGTACCTCG 3′ | 5′ GTCCTTGTCACCCAGATGAAG 3′ |
GUS | 5′ GGTCGTGATGTGGTCCTGTC 3′ | 5′ TGTCTGCGTCATATCTGGTATTG 3′ |
GPX: glutathione peroxidase; SOD: superoxide dismutase; NOX: NADPH oxidase.
DUOX1: dual oxidase 1; GUS: beta glucuronidase.
All results are expressed as mean ± standard error of the mean and were analyzed by One-Way ANOVA followed by Bonferroni’s Multiple Comparison Test. Statistical analyses were done using GraphPad Prism (version 5.01, GraphPad Software Inc., San Diego, USA) and the minimum level of significance was set at
First, we evaluated by qPCR the expression of hallmark genes related to muscle contraction, energy metabolism, and Ca2+ handling in order to better characterize the types of skeletal muscle fibers studied (Table
Real-time qPCR. Values were calculated to compare mRNA expression pattern level of genes in rat skeletal muscle. Values were normalized for soleus.
WG | RG | SOL | |
---|---|---|---|
| |||
MHC1 | 0.0004 | 0.12 | |
MHC2a | 0.03 | | 1 |
MHC2x | 149 | | 1 |
MHC2b | | 320 | 1 |
| |||
PGC1 | 0.58 | | 1 |
UCP3 | 0.54 | | 1 |
GDP1 | | 9.3 | 1 |
GDP2 | | 8.1 | 1 |
| |||
SERCA1 | | 10.3 | 1 |
SERCA2 | 0.0041 | 0.3 | |
Data shown as mean of 5–8 rats.
Another parameter used in the characterization of skeletal muscle fiber types was their oxygen consumption capacity. We observed that WG consumed less oxygen than RG and SOL after stimulation with malate, pyruvate, and succinate (Figure
Basal levels of oxygen (O2) consumption and citrate synthase activity in slow- and fast-twitch oxidative and glycolytic skeletal muscle fibers of rats. (a) Maximal coupled O2 consumption after pyruvate, malate, and succinate (PMS) addition and proton leak and O2 consumption related to ATP synthesis and (b) citrate synthase activity. Data were obtained with 10 animals from at least two independent experiments and are shown as mean ± SEM.
Thus, based on our results we classified the muscles as follows: WG as fast-twitch glycolytic, RG as fast-twitch oxidative, and SOL as slow-twitch oxidative muscles.
NOX activity was significantly higher in SOL muscle in comparison to RG and WG; moreover, NOX activity was higher in RG when compared to WG (Figure
NADPH oxidase activity (a) and mRNA (b) basal levels of rat skeletal muscles. H2O2 production was determined in the microsomal fraction by the Amplex red/horseradish peroxidase assay. mRNA levels were determined by qPCR and were expressed relative to soleus muscle. Data were obtained with 10 animals from at least two independent experiments and are shown as mean ± SEM.
Total SOD activity was significantly lower in WG in comparison to SOL muscle and RG (Figure
Basal levels of antioxidant enzymes activities and mRNA levels of rat skeletal muscles. Superoxide dismutase (a), glutathione peroxidase (b), and catalase (c) activities were measured by spectrophotometry. mRNA levels (d) were determined by qPCR and were expressed relative to soleus muscle. Data were obtained with 10 animals from at least two independent experiments and are shown as mean ± SEM.
Thiol residues are mainly found in proteins and in low-molecular-mass metabolites, such as the highly abundant glutathione (GSH), and can be reversibly oxidized by ROS to nitrosothiols or sulfenic acids, decreasing their cellular levels. Interestingly, reactive protein thiol levels were higher in SOL in comparison to RG and WG and did not differ between RG and WG (Figure
Basal levels of reactive protein thiol levels of rat skeletal muscles. Total sulfhydryl groups were measured by the reaction of thiols with DTNB, evaluated in a spectrophotometer at 412 nm. Data were obtained with 10 animals from at least two independent experiments and are shown as mean ± SEM.
After physical exercise training, NOX activity was significantly increased in SOL (Figure
NADPH oxidase activity and mRNA levels of rat white gastrocnemius (a, b), red gastrocnemius (c, d), and soleus (e, f) skeletal muscles. H2O2 production was determined in the microsomal fraction by the Amplex red/horseradish peroxidase assay. mRNA levels were determined by qPCR and were expressed relative to soleus muscle. Data were obtained with 10 animals from at least two independent experiments and are shown as mean ± SEM.
To our knowledge, this is the first study that compares NOX expression and activity among different muscle fiber types. Our results raise important questions related to the redox homeostasis of skeletal muscle: (1) NOX expression and activity are higher in oxidative slow-twitch type I skeletal muscle fibers, (2) the increased NOX-derived ROS production found in oxidative slow-twitch type I skeletal muscle seems to be counterbalanced by a higher antioxidant defense, and (3) depending on the physiological stimulus, NOX enzymes can be modulated and might contribute to skeletal muscle adaptations through ROS generation.
Firstly, we showed that RG consumes more oxygen in all tested conditions than SOL and GB, while SOL consumes more oxygen than GB. Previous studies indicate that mitochondrial density is higher in oxidative slow-twitch type I fibers than in type II fibers [
Residual oxygen consumption in isolated fibers, which is also called the nonmitochondrial oxygen consumption, although nonsignificant, tended to be higher in SOL. This result prompted us to evaluate the possible contribution of NOX enzymes to the different rate of oxygen consumption found in the different fiber types. It has been shown that skeletal muscles express NOX enzymes [
As discussed before, ROS production is important for skeletal muscle physiology, but increased ROS production can be deleterious due to the oxidation of macromolecules, such as lipids, nucleic acids, and proteins. So, cells have antioxidant defense mechanisms in order to protect them against the deleterious effects of ROS. As a result, higher ROS availability may result in the specific activation of redox-sensitive transcription factors, such as activator protein-1 (AP-1) and nuclear factor kappa B (NF-
Skeletal muscle redox imbalance favors the accumulation of ROS and is associated with loss of muscle mass, inflammation, and degenerative diseases, such as sarcopenia and muscular dystrophies [
Muscular dystrophies are inherited disorders and have been associated with the overexpression of NOX2, NOX4, DUOX1, and p47phox [
Several evidences show that ROS are able to change the processes of myogenesis
As NOX enzymes play important roles in muscle physiology, we speculated that their activities are modulated by physical exercise. In fact, in the present report we have shown that aerobic physical exercise training was able to increase NOX activity only in the SOL and RG fibers, with no differences in WG. It is important to note that the animals trained at 60% of maximum running speed testing, which corresponds to its maximal lactate steady state (MLSS) [
The role of ROS in promoting muscle adaptive responses to training is well known. Indeed, PGC-1
In conclusion, we demonstrated that NOX activity and expression differ depending on the skeletal muscle fiber type, being higher in the fibers that carry a more sustained contraction. Despite the differences in ROS generation, muscle redox homeostasis is probably maintained due to the increased antioxidant activity found in muscles that show higher ROS generation ability. Taken together, our findings point out the potential role of NOX enzymes in skeletal muscle physiology and in their adaptation to exercise training.
The authors declare that they have no conflict of interests.
The authors thank the following Brazilian institutions for financial support: Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ), and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES).