We have hypothesized that the adaptive response to low doses of ionizing radiation (IR) is mediated by oxidized cell-free DNA (cfDNA) fragments. Here, we summarize our experimental evidence for this model. Studies involving measurements of ROS, expression of the NOX (superoxide radical production), induction of apoptosis and DNA double-strand breaks, antiapoptotic gene expression and cell cycle inhibition confirm this hypothesis. We have demonstrated that treatment of mesenchymal stem cells (MSCs) with low doses of IR (10 cGy) leads to cell death of part of cell population and release of oxidized cfDNA. cfDNA has the ability to penetrate into the cytoplasm of other cells. Oxidized cfDNA, like low doses of IR, induces oxidative stress, ROS production, ROS-induced oxidative modifications of nuclear DNA, DNA breaks, arrest of the cell cycle, activation of DNA reparation and antioxidant response, and inhibition of apoptosis. The MSCs pretreated with low dose of irradiation or oxidized cfDNA were equally effective in induction of adaptive response to challenge further dose of radiation. Our studies suggest that oxidized cfDNA is a signaling molecule in the stress signaling that mediates radiation-induced bystander effects and that it is an important component of the development of radioadaptive responses to low doses of IR.
Human beings are constantly exposed to background sources of IR both of natural (terrestrial and cosmic) and artificial origin (nuclear energy, nuclear accidents, radiation for medical purposes) [
The effects of information transfer from irradiated (target) cells to adjacent, nontargeted cells (RIBE) have been observed for a number of damaging agents of both physical and chemical nature in many types of eukaryotic cells and cover a variety of physiological effects including genomic instability, cell death, and/or RAR [
Research on the role of cell-free DNA (cfDNA) circulating in the blood of healthy persons and patients has led to the hypothesis that oxidized cfDNA (cfDNAox) released from dying cells could mediate RIBE and RAR, and further information on our own research on this subject can be found here [
Stem cells are undifferentiated cells that have a potential for unlimited division and differentiation into many types of cells. As they have a longer life span, they are more likely to accumulate mutations and lead to cancer [
MSCs were derived from adipose tissue of patients subjected to surgical operation. To obtain stromal cells, minced adipose tissue was digested with collagenase as described previously [
MSCs were characterized by standard markers using fluorescence-activated cell sorting (FACS): MHC molecules (HLA-ABC+) and adhesion molecules (CD44+, CD54 (low), CD90+, CD106+, CD29+, CD49b (low), and CD105); however, they were negative for hematopoietic markers (CD34−, CD45−, and HLA-DR−) and the marker CD117 (Dominici et al. 2006). Moreover, cells differentiated into adipocytes in the presence of inducers in a kit for adipogenic differentiation (STEMCELL Technologies). Ethical approval for the use of MSCs was obtained from the Regional Committees for Medical and Health Research Ethics (approval number 5).
MSCs were irradiated in a growth medium at 20°C using a pulsed Röntgen radiation unit (ARINA-3, Spectroflash, Russia). The voltage on the X-tube was ∼160 kV (∼60 keV), peak energy in the spectrum was 60 keV, and dose rate was 10 cGy/min. Nonirradiated cells were used as controls.
MSCs were washed in Versene solution (PanEco, Moscow, Russia) and then treated with 0.25% trypsin, washed with medium, and suspended in PBS. Cells were fixed with paraformaldehyde (PFA, Sigma, 2%, 37°C, 10 min), washed three times with 0.5% BSA-PBS, and permeabilized with 0.1% Triton X-100 in PBS (15 min, 20°C) or with 90% methanol (3 h, 4°C). The cells were washed 3× with 0.5% BSA-PBS and labeled with primary antibodies (1
Cells were detached, washed with PBS, and treated with annexin V-FITC and PI in buffer (10 mM HEPES, pH 7.4, 140 mM NaCl, 2.5 mM CaCl2) at 20°C for 15 min and immediately analyzed using an automated cell counter (Countess II FL, Thermo Fisher) or FACS (CyFlow Space).
After irradiation or treatment with cfDNA, cells were washed with PBS and incubated with 10
Cells were grown in slide flasks and washed in PBS. Then, 10
Cells were grown to 80–90% confluency in 96-well plates (Nunclon, Germany). After irradiation or treatment with DNA, cells were incubated with 10
Cells were grown in slide flasks, fixed in 2% PFA (4°C, 20 min), washed with PBS, and then permeabilized with 0.1% Triton X-100 in PBS (15 min, 20°C), followed by blocking with 0.5% BSA in PBS (1 h, 4°C), and incubated overnight with rabbit polyclonal antibody against LC3 (Epitomics, Cambridge, MA),
Total mRNA was isolated using RNeasy Mini kits (Qiagen, Germany), treated with DNAse I, and reverse transcribed by a Reverse Transcriptase kit (Sileks, Russia). The expression profiles were obtained using qRT-PCR with SYBR Green PCR Master Mix (Applied Biosystems). The mRNA levels were analyzed using the StepOnePlus (Applied Biosystems); the technical error was approximately 2%. The following primers were used (Sintol, Russia):
The standard curve method was used for the quantification of RNA levels.
DNAs were dissolved in 20
Genomic DNA was isolated from MSCs by phenol-chloroform extraction. Hydrolysis by DNAse I (Invitrogen, USA) was performed until the maximal length of the DNA fragments was below 15 kb. The resulting DNA solution (100
Plasmid pEGFP-C1 that contains the
In order to obtain the DNA fragment, PCR with primers GF_601 gggcccgggatccaccggatctagataatcgccgtcccgcccgccgcctt and C10 tttttggatccccccccccccaaggcggcgggcgggacggcga was used.
The fragment was purified by agarose gel electrophoresis and treated with BamHI. The vector pEGFP-C1 was treated with BamHI and added to the DNA fragments with subsequent ligation with T4 DNA ligase. Competent
A cell suspension in low-melting-point agarose was dropped onto slides precoated with 1% normal-melting-point agarose. The slides were placed in a solution (10 mM Tris-HCl, pH 10, 2.5 M NaCl, 100 mM EDTA, 1% Triton X-100, 10% DMSO, 4°C, 1 h) and then in electrophoresis buffer (300 mM NaOH, 1 mM EDTA, pH > 13). Electrophoresis was performed for 20 min at 1 V/cm, 300 mA. The slides were fixed in 70% ethanol and stained with SYBR Green I (Invitrogen, USA).
All the reported results were reproduced at least three times as independent biological replicates. In FACS, the median of signal intensities was analyzed. The figures show the mean and standard deviation (SD) values. The significance of the observed differences was analyzed with nonparametric Mann–Whitney
This study was performed using human MSC lines obtained from different donors and characterized by their CD marker expression (Table
Sources and characteristics of MSC lines. Cell lines were obtained from the Research Centre for Medical Genetics, Moscow.
Cell | Source | Surface markers | |||
---|---|---|---|---|---|
MSC | Adipose tissue from mammary gland | CD34− | CD45− | HLA-ABC+ | HLA-DR− |
CD44+ | CD29+ | CD49b low | CD54 low | ||
CD90+ | CD106− | CD105 low | CD117− |
The concentrations of cfDNA in the growth medium used here are 12 ± 2 ng/ml [
LDIR can lead to death of a part of the cell population during the first min of exposure. The amount of apoptotic cells after irradiation was assessed using the marker of apoptosis annexin V. 10–20 min after irradiation, cells exhibited signs of apoptosis, and the fraction of apoptotic cells increases 2–2.5-fold (Figure
Low-dose radiation causes a strong antiapoptotic response. (a) (1) Flow cytometric enumeration of cells with signs of early apoptosis by FL1 versus FSC. R: gated area, annexin V-positive cells in total population; (2) distribution of fluorescence intensities of cells stained with annexin V-FITC. (b) Signal intensity of FL1-R (1) and average signal intensity of FL1-annexin V-FITC (2) in irradiated (10 cGy, 15 min and 2 h after exposure) and exposed to cfDNAox and cfDNAoxR (50 ng/ml, 15 min and 2 h) cells (flow cytometry). (c) Fluorescence microscopy of irradiated and exposed to cfDNAox MSCs stained with BCL2 (anti-BCL2-antibody and secondary FITC-conjugated antibodies) and DAPI (40×),
CG-rich cfDNA fragments are prone to oxidation. We further investigated if the CG-rich oxidized cfDNA penetrates into cells after treating them with 10 cGy of IR.
A plasmid containing a marker GFP gene and (G)n repeats that are easy to oxidize was constructed, and its penetration into cells was investigated by fluorescence microscopy and flow cytometry. The cells were treated with plasmids in two ways: (1) the plasmid was added to the medium at a concentration of 100 ng/ml and the cells were then incubated for 24 h and (2) cells were irradiated directly after adding the plasmid to the medium. After cultivation, cells were imaged with the same exposure and magnification. Cells treated by method (1) exhibited weak fluorescence in the cytoplasm, while cells treated by method (2) had a higher level of fluorescence which indicates penetration of the plasmids into the cytoplasm (Figure
As CG-rich oxidized cfDNA penetrates into cells, it might mediate early responses to LDIR (10 cGy).
As we showed previously, GC-rich cfDNA can play a role of a signaling molecule in RIBE when lymphocytes from peripheral blood are exposed to LDIR [
cfDNA from medium of cells 15 min after irradiation was added to MSCs. As the cfDNA in these conditions contains a high level of oxidized bases, model fragments of oxidized DNA were prepared (Table
Content of 8-oxodG per 106 nucleotides in different types of DNA.
Content of 8-oxodG per 106 nucleotides | |
---|---|
gDNA | <0.01 |
cfDNAox | 400 |
cfDNAoxR | 200 |
cfDNAox fragments were prepared by treatment of gDNA with H2O2 and Fe2+/EDTA and the level of 8-oxodG was assessed (Table
The effect of cfDNAox, cfDNAoxR, or LDIR on the levels of ROS and DNA breaks was investigated. In order to confirm the role of DNA oxidation in these processes, cells were also treated with unoxidized genomic DNA and unoxidized cfDNA from the medium of control cells.
LDIR induces oxidative stress in cells, increasing ROS production. Intracellular ROS level was assessed using H2DCFH-DA (2,7-dichlorofluorescin diacetate) [
(a) A plasmid containing a marker GFP-gene and containing (G)n repeats that are easy to oxidate penetrates into cells treated with 10 cGy of IR (fluorescent microscopy, 40x). (b–e) Both low-dose radiation (10 cGy) and cfDNAox fragments induce a short-term increase in ROS production. (a, b) Change of DCF fluorescence in the presence of 10
Increase in ROS production by cfDNAox fragments can be connected with increased expression of
The main producer of ROS is the NADPH oxidase family (NOX) that includes
And indeed, LDIR and cfDNAox and cfDNAoxR fragments induce a 2–2.5-fold increase in
Both low-dose radiation (10 cGy) and cfDNAox and cfDNAoxR (50 ng/ml) fragments induce an increase in
The increased level of ROS can induce damage to the cells and cause oxidation of genomic DNA.
LDIR, as well as cfDNAox and cfDNAoxR, causes an increase in ROS production that leads to oxidation of nuclear DNA. An FITC-labeled antibody was used to detect 8-oxodG. Control cells did not contain FITC-labeled antibody; there were single cells in the population that had labeled cytoplasm, possibly due to oxidized mitochondrial DNA. Three main types of cells are present after irradiation: (1) with labeled nuclei, (2) with labeled cytoplasm, and (3) both nucleus and the cytoplasm are labeled. Fifteen–20 min after irradiation with 10 cGy, the fluorescent intensity of the cytoplasm and the amount of stained nuclei increased (Figures
Low-dose radiation and cfDNAox and cfDNAoxR fragments cause oxidation in nuclear DNA. (a, b) Cells stained with antibodies to 8-oxodG (secondary FITC-conjugated antibodies) and DAPI (fluorescence microscopy, 40x (a), 100x (b)). (c, d) Flow cytometry detection of 8-oxodG: (c) (1) analysis of irradiated MSCs stained with antibodies to 8-oxodG FL1-8-oxodG versus SSC plots. Gate R encircles the fraction of MSCs with elevated values of 8-oxodG (secondary FITC-conjugated antibodies); (c) (2) distribution of the cells with varying 8-oxodG contents. (d) (1) Signal intensity of FL1-R; (d) (2) median signal intensity of FL1 (mean value for three independent experiments).
Two subpopulations of cells were detected by flow cytometry; 3–5% of the total population showed high levels of 8-oxodG (Figure
The total amount of 8-oxodG fluorescence 20–30 min after irradiation or treatment with cfDNAox and cfDNAoxR fragments increases 7-8-fold (Figure
Oxidative modification of nuclear DNA can lead to DNA breaks in cell nuclei.
Since oxidation of DNA can cause single- and double-strand breaks [
Comet assays were performed 5 min and 3 h after exposure to LDIR (10 cGy) or to cfDNAox and cfDNAoxR fragments. Four types of cells were present in control populations: (1) cells without DNA breaks, (2) cells with few DNA breaks, (3) cells with fragmented DNA, and (4) apoptotic cells with very damaged DNA (Figure
Low-dose radiation and cfDNAox and cfDNAoxR fragments (50 ng/ml) cause DNA breaks in nuclear DNA of exposed MSCs. (a) Different types of nuclei with varying degree of DNA damage (100×). (b) Nuclei of irradiated (10 cGy) and exposed to cfDNAox (50 ng/ml) MSCs, 5 min and 3 h after exposure; (c) cumulative histograms for tail moment of irradiated (10 cGy, 5 min and 3 h) and exposed to cfDNAox (50 ng/ml, 5 min and 3 h) MSCs; (d) percentage of DNA within tails. The significance of differences with the control in the obtained distributions was analyzed by means of the Kolmogorov-Smirnov statistics.
DSBs were revealed by immunostaining with antibodies against the histone
Low-dose radiation and cfDNAox and cfDNAoxR fragments cause DNA breaks and
FACS allows assessing the average amount of H2AX histone in cells, but these numbers do not always reflect the real degree of DNA damage [
Thus, the damage to the cell nuclei that is induced by LDIR can be mediated by oxidized DNA fragments. cfDNAox penetrates into cells increasing ROS production and leading to oxidative stress and multiple DNA breaks the amount of which decreases 2 h after irradiation or start of incubation with oxidized cfDNA. We researched if the DNA breaks are repaired or that cells with multiple DNA breaks undergo cell death within these 2 h.
DNA damage induced by IR activates signaling cascades that control DNA repair [
LDIR or treatment with cfDNAox and cfDNAoxR fragments leads to a 3.5–4.5-fold increment in the level of mRNA transcripts from the
DNA damage induced by low-dose radiation and cfDNAox and cfDNAoxR fragments activates reparation of nuclear DNA. (a) (1) Flow cytometry detection of BRCA2 in irradiated (10 cGy) and control cells stained with anti-BRCA2 antibodies and secondary FITC-conjugated antibodies. Gate R encircles the fraction of MSCs with elevated values of FL1- BRCA2; (2) distribution of cells with varying BRCA2 contents. (b) The signal intensity of FL1-R (1) and average signal intensity of FL1-BRCA2 (2) in irradiated cells (10 cGy, 15 min and 2 h after exposure) and cells exposed to cfDNAox and cfDNAoxR (50 ng/ml, 15 min and 2 h) (flow cytometry). (c) Linear correlation between the levels of
Thus, DNA breaks activate DNA reparation system in the treated cells. As DNA reparation requires time, we were expecting to see a short-term arrest of the cell cycle after treating cells with LDIR or cfDNAox or cfDNAoxR fragments.
Oxidative stress and DNA damage lead to the arrest of the cell cycle at all stages and block proliferation [
Low-dose radiation and cfDNAox fragments cause a short-term arrest of cell cycle and decreases proliferation. (a) (1) Proportions of cells that contain the amount of DNA characteristic for G1, S, and G2/M phases of the cell-cycle (flow cytometry). (a) (2) Proportions for control cells,10 cGy irradiated cells, and cells treated with oxidized DNA. (b) Dynamics of the change of fraction of proliferating cells (Ki-67+ fraction) in the population (flow cytometry): (1) distribution of cells with varying Ki-67 content; (2) average signal intensity of FL1-Ki-67+ in irradiated cells (10 cGy, 15 min and 2 h after exposure) and cells exposed to cfDNAox (50 ng/ml, 30 min and 2 h).
PCNA is a transcription factor for polymerase Δ that is a part of the DNA repair system. We observed a 40–60% increase of the level of PCNA 30 min after irradiation or treatment of cells with oxidized cfDNA (Figure
Ten cGy of radiation or addition of cfDNAox and cfDNAoxR fragments to the medium increases the number of cells in G1 and G0/G1 30 min after exposure, and thus, these factors arrest the cell cycle in G1 (Figure
Exposure to LDIR or addition of cfDNAox and cfDNAoxR fragments causes a 1.5–2-fold decrease in the level of expression of CCND1 and a 1.5–2-fold increase in expression of
Thus, DNA damage leads to a short-term arrest of the cell cycle and activation of DNA reparation. As a result, the level of proliferation, as well as the amount of cells in the population, increases in 2-3 h after treatment. The increased amounts of cells in the population can be a result of low level of apoptosis.
The amount of apoptotic cells after irradiation or treatment with cfDNAox and cfDNAoxR fragments was assessed using a marker of apoptosis, annexin V, and FACS (Figure
Bcl2 is a family of proteins that are crucial for cell survival and apoptosis regulation. It includes three groups of interacting and functionally different proteins [
Antiapoptotic processes are activated 20 min after irradiation or the addition of cfDNAox and cfDNAoxR fragments to the medium, and the levels of antiapoptotic genes
Dependence of the changes in the levels of antiapoptotic genes
Gene | Changes in the expression levels, arb.un. | ||||
---|---|---|---|---|---|
Treatment | Time | 10 cGy | cfDNAox | cfDNAoxR | gDNA |
|
30 min | 2.6 ± 0.3 |
2.3 ± 0.2 |
2.4 ± 0.2 |
1.1 ± 0.2 |
2 h | 4.1 ± 0.4 |
3.1 ± 0.2 |
3.3 ± 0.3 |
1.0 ± 0.2 | |
24 h | 3.9 ± 0.3 |
2.9 ± 0.2 |
2.9 ± 0.3 |
1.3 ± 0.3 | |
48 h | 2.8 ± 0.3 |
3.1 ± 0.3 |
2.6 ± 0.2 |
1.8 ± 0.3 |
|
|
30 min | 1.6 ± 0.2 |
2.4 ± 0.2 |
2.5 ± 0.3 |
1.0 ± 0.2 |
2 h | 2.1 ± 0.2 |
2.2 ± 0.1 |
2.4 ± 0.2 |
1.1 ± 0.2 | |
24 h | 2.1 ± 0.3 |
2.8 ± 0.3 |
2.3 ± 0.2 |
1.3 ± 0.2 | |
48 h | 1.8 ± 0.3 |
1.6 ± 0.2 |
2.2 ± 0.2 |
1.7 ± 0.3 |
|
|
30 min | 1.4 ± 0.2 | 1.6 ± 0.1 |
1.6 ± 0.1 |
1.1 ± 0.2 |
2 h | 1.9 ± 0.3 |
1.5 ± 0.2 |
1.7 ± 0.2 |
1.2 ± 0.3 | |
24 h | 2.3 ± 0.2 |
2.7 ± 0.3 |
2.4 ± 0.2 |
1.1 ± 0.3 | |
48 h | 2.8 ± 0.3 |
2.4 ± 0.3 |
1.9 ± 0.2 |
1.6 ± 0.2 | |
|
30 min | 2.4 ± 0.2 |
1.4 ± 0.2 | 1.8 ± 0.2 |
1.0 ± 0.3 |
2 h | 2.6 ± 0.2 |
2.1 ± 0.2 |
2.3 ± 0.3 |
1.0 ± 0.2 | |
24 h | 2.6 ± 0.3 |
2.7 ± 0.3 |
2.6 ± 0.2 |
1.6 ± 0.3 |
|
48 h | 2.4 ± 0.2 |
2.4 ± 0.3 |
2.5 ± 0.2 |
2.5 ± 0.3 |
|
|
30 min | 2.2 ± 0.1 |
1.2 ± 0.2 | 1.2 ± 0.2 | 1.0 ± 0.2 |
2 h | 2.5 ± 0.2 | 1.9 ± 0.2 |
1.8 ± 0.2 |
1.2 ± 0.3 | |
24 h | 2.5 ± 0.2 | 2.6 ± 0.3 |
2.5 ± 0.3 |
1.6 ± 0.3 | |
48 h | 2.0 ± 0.3 | 2.5 ± 0.4 |
2.5 ± 0.4 |
2.0 ± 0.4 |
|
|
30 min | 1.6 ± 0.2 |
1.5 ± 0.2 |
1.4 ± 0.2 | 1.0 ± 0.2 |
2 h | 0.8 ± 0.2 | 0.8 ± 0.2 | 0.9 ± 0.2 | 1.1 ± 0.3 | |
24 h | 0.8 ± 0.2 | 0.9 ± 0.2 | 1.1 ± 0.2 | 0.9 ± 0.2 |
Oxidative stress caused by an increase of ROS production can activate an antioxidant response in which one of the main regulators is transcription factor NRF2 [
Low-dose radiation and cfDNAox and cfDNAoxR fragments activate antioxidant response. (a) Dependence of changes in the levels of NRF2 mRNA in irradiated cells and cells exposed to cfDNAox and cfDNAoxR on the time after exposure (RT-PCR); mRNA levels—average expression of genes in treated cells compared to controls (three biological replicates). Reference gene,
The key event of antioxidant response development is the translocation of NRF2 to the nucleus. To analyze the effect of oxidized DNA fragments on the location of NRF2, antibodies against NRF2 and fluorescence microscopy were used (Figure
We assessed the effect of oxidized cfDNA and LDIR on the survival of human adipose-derived mesenchymal stem cells (haMSCs) that were subsequently exposed to irradiation at 2 Gy. haMSCs were grown for 3 h in presence of cfDNAox and cfDNAoxR and then irradiated with 2 Gy. In a different experiment, we first irradiated cells with 10 cGy, cultivated them for 3 h, and then irradiated again with a dose of 2 Gy and grew them in fresh media for 48 h more. MTT tests demonstrated a statistically significant decrease in the cell death induced by 2 Gy of irradiation in cells that were pretreated with oxidized cfDNA or preirradiated with 10 cGy (
The effect of cfDNAox on the survival of cells and formation of
The predominant hypothesis concerning the origin of cfDNA is that its main source is dead cells [
Increased levels of 8-oxodG in cfDNA can be a sign of oxidative stress, in our case, as a consequence of LDIR. It should be noted that GC-rich fragments within genomic DNA tend to accumulate oxidative damage as well. We have previously demonstrated that chronic exposure to gamma-neutron or tritium
The cellular response to irradiation depends on a wide variety of factors, but the most important of these is a substantial increase in the level of ROS within a time frame of several seconds to 2–5 min [
Ionizing low-LET irradiation increases the rate of apoptosis in various cell types within min after irradiation. Dying cells release fragments of chromatin, contributing to the pool of cfDNA and increasing its concentration in the medium. cfDNA from irradiated cells contains significantly larger amounts of the oxidation marker 8-oxodG than cfDNA of control (nonirradiated) cells or cellular DNA of irradiated cells [
A variety of studies concern RIBE and RAR based on various parameters of target and bystander cells [
The goal of this work was to compare the action of model oxidized DNA fragments (cfDNAox) and cfDNA from the medium of irradiated cells (cfDNAoxR) with those of LDIR (10 cGy) on human adipose-derived MSCs, and we obtained hard evidence that their reaction to LDIR can be mediated by oxidized GC-rich cfDNA fragments. Firstly, the responses of cells to these fragments are identical to those to 10 cGy of radiation. Thus, cfDNA fragments are stress signaling molecules that regulate RAR to LDIR. We demonstrated that the radiation leads to the increase of oxidized cfDNA in the culture medium. We used a genetic construction containing an easy-to-oxidize (G)n repeat to show that the oxidized cfDNA can rapidly penetrate into the cytoplasm and induce a short-term increase in ROS production, a process implemented by the NOX4 oxidase. This, on the one hand, leads to a short-term oxidative modification of nuclear DNA, but, on the other hand, activates antioxidant systems. An increased level of ROS leads to DNA damage and DSBs, but, at the same time, activates DNA repair and minimizes damage. Moreover, 10 cGy of radiation evoke a strong antiapoptotic response.
Taken together, these data indicate that the cascade of events in cfDNAox signaling may be the following: irradiation → primary oxidative stress → oxidation of genomic DNA → apoptosis of some irradiated cells → release of oxidized cfDNAoxR → ROS production → ROS induces oxidative modifications of nuclear DNA, rapidly repaired DNA breaks, and short-term arrest of the cell cycle → activation of DNA repair systems and antioxidant response → inhibition of apoptosis → radioadaptive responses (RAR) (Figure
Proposed mechanisms for the development of radioadaptive responses and bystander effect. Irradiation induces primary oxidative stress and oxidation of genomic DNA → apoptosis of some irradiated cells → release of oxidized cfDNAoxR → reactive oxygen species (ROS) production → ROS induces oxidative modifications of nuclear DNA, rapidly repaired DNA breaks, short-term arrest of the cell cycle → activation of DNA reparation systems and antioxidant response → inhibition of apoptosis. Thus, we conclude that cfDNAox that appears after irradiation is a signaling molecule in the stress signaling that mediates radiation-induced bystander effects.
The secondary oxidative stress that is evoked in bystander cells occurs after interaction of cfDNAox with its receptors on the cell surface or inside, possibly transmembrane proteins of the toll-like receptor family, namely TLR9 [
ROS level increases drastically during the first minutes after the addition of cfDNAox or cfDNAoxR to the medium, but decreases 30 min after the addition. We propose that activation of ROS production is connected to a changed expression of ROS-coding enzyme/enzymes such as the
The authors do not have any competing interests.
This work was supported by the Russian Foundation for Basic Research (Grant nos. 16-04-01099 A and 16-04-00576 A).