Methionine sulfoxide reductase B1 (MsrB1) is a member of the selenoprotein family, which contributes to the reduction of methionine sulfoxides produced from reactive oxygen species (ROS) by redox processes in energy pathways. However, few studies have examined the role of MsrB1 in human hepatocellular carcinoma (HCC). We observed that MsrB1 is highly expressed in HCC tissues and that its expression correlated with the prognoses of patients with HCC after hepatectomy.
Hepatocellular carcinoma (HCC) is the fifth most common cancer worldwide and causes half a million deaths each year. In addition to novel therapeutic methods, new and useful prognosis-determining methods, especially methods enabling clinicians to monitor biotherapies, would be extremely beneficial with respect to the treatment of this disease. Among the antioxidant enzymes induced by reactive oxygen species (ROS), methionine sulfoxide reductases (MSRs) are unique in their ability to direct protein repair and indirectly scavenge ROS. Within this subfamily, MsrB1, a selenoprotein that contains a selenocysteine residue in place of the catalytic cysteine residue normally present in other MsrBs [
In this study, we observed that MsrB1 is highly expressed in HCC tissues and that its expression correlated with the prognoses of patients with HCC after hepatectomy. MsrB1 interfered with HCC cell proliferation and invasion
Samples from 135 patients who underwent hepatic resection in our hospital (Sir Run Run Shaw Hospital, Zhejiang University School of Medicine, Zhejiang, China) between January 2006 and December 2012 were collected for this study. Letters of consent were obtained from all patients, and our experimental protocols were approved by the local ethics committee. Patient charts were reviewed to obtain clinical data regarding age, gender, tumor size, AFP levels, HBsAg positivity, portal vein-emboli and metastases, TNM stage (AJCC), and tumor differentiation.
Seven human HCC cell lines (HepG2, Hep3B, Huh-7, Bel-7402, SK-Hep-1, SMMC-7721, and MHCC-LM3) and a liver cell line (HL7702) were purchased from Cell Bank of Type Culture Collection of Chinese Academy of Sciences, Shanghai Institute of Cell Biology, Chinese Academy of Sciences, and were cultivated in accordance with the supplier’s instructions. The HepG2, Hep3B, Huh-7, SK-Hep-1, and HCCLM3 cell lines were cultured in Dulbecco’s modified Eagle medium (DMEM; Gibco-Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS), and the snu387, Bel-7402, SMMC-7721, and HL7702 cell lines were cultured in 1640 complete medium supplemented with 10% FBS.
Antibodies to phosphorylated Erk1/2 (#4376, diluted 1/1000), Mek (#9154, diluted 1/1000), p53 (#2521, diluted 1/1000), cleaved PARP (#9542, diluted 1/1000) and caspase 3 (#9661, diluted 1/1000), PCNA (#2586, diluted 1/1000), and EMT Antibody Sampler Kit (#9782, diluted 1/500–1000) were all purchased from Cell Signaling Technology Inc. Antibodies to MsrB1 (ab71175, diluted 1/1000), ki67 (ab209897, diluted 1/1000), and TGF-
We selected tissues from 15 tumor-free liver samples and 7 HCC samples, as well as HCC cell lines (HePG2, HeP3B, LM3, and BEL-7402) and a liver cell line (HL-7702), for semiquantitative RT-PCR amplification of specific genes. Then, we performed quantitative real-time PCR (qPCR) amplification of MsrB1 to detect its mRNA expression levels in HL-7702, HePG2, HeP3B, and BEL-7402/4/5 cells. The MsrB1 antibody was used to detect the MsrB1 protein expression in 8 different HCC cell lines (Huh7, HepG2, Hep3B, LM3, BEL-7402, SMMC-7721, snu387, and SK-HeP1). This procedure has been described in detail in a subsequent section.
To evaluate relative DNA copy numbers, we used 56 pairs of DNA samples from the cancer tissues and normal tissues of patients with HCC. qPCR amplification was conducted using a TaqMan Copy Number Assay Kit (Hs03918287_cn; ABS, USA). The PCR reactions and analyses were performed according to the manufacturer’s instructions. Briefly, PCR was conducted with a total sample volume of 20
We downloaded and analyzed the RNA-seq data pertaining to 178 HCC cases from the TCGA database. Based on MsrB1 expression levels, we classified the data into 2 groups separated by a median value and analyzed the correlation between MsrB1 mRNA expression and patient prognosis.
A total of 135 pathological sections were immunohistochemically stained, and 125 of these cases underwent complete follow-up evaluations. Immunohistochemistry (IHC) was performed as described previously [
Tissue sections were incubated with an MsrB1 primary antibody (1 : 100 dilution; DMAB14855, Reactive Diagnostics, USA) overnight at 4°C. Then, the appropriate secondary antibody was applied to the sections, as was a diaminobenzidine (DAB)+ chromogen. The tissue slides were lightly counterstained with hematoxylin and sealed. MsrB1 expression was scored based on the numbers of positive cells and the intensity of cytoplasmic staining using the following four-point system: −, negative; +, weak; ++, moderate; and +++, strong. To examine the association between MsrB1 expression and clinicopathological features, we divided the patients into the following two groups: a low expression (−/+) group and a high expression (++/+++) group. The immunostaining results were scored independently by two pathologists blinded to patient clinical information.
The HCC cell lines LM3 and snu387 were infected with MsrB1-knockdown shRNA or negative-control shRNA with puromycin. Stably infected cells were selected for further study.
Total RNA was extracted from the snu387 cells after MsrB1 shRNA transfection. Three biological replicates were used. Gene expression profiling was conducted by the Biotechnology Corporation (Shanghai, China) using Affymetrix PrimeView human gene expression arrays. All data were analyzed according to the manufacturer’s protocol. Raw data generated from Affymetrix CEL files were normalized by RMA background correction, and values were log2 transformed. To enrich the
Cell viability was determined via MTT assay. Briefly, negative-control (NC) and knockdown (sh-MsrB1) cells were seeded in 96-well flat-bottomed plates at a density of 1 × 104 cells/well. After 24 h, the medium was replaced with medium with/without sorafenib (3
Then, we seeded cells and wild-type cells in 6-well plates at a 1 : 1 ratio. After incubation, flow cytometry was used to measure the percentage of green fluorescence.
The effects of MsrB1 on HCC cell proliferation were also tested using 5-ethynyl-2
For colony formation assays in 2D culture, we separately plated 1000 cells from the indicated two groups in 10 cm2 dishes and incubated the cells for 2 weeks at 37°C and 5% CO2. The surviving colonies (≥50 cells/colony) were quantified after crystal violet staining.
All
Cell cycle distributions and apoptotic cell percentages were determined by flow cytometry, as described previously [
The treated cells were cultured on glass coverslips and fixed in 4% paraformaldehyde in PBS for 10 min, permeabilized in 0.1% Triton X-100 in PBS for 4 min, blocked with 1% BSA/PBS for 1 h, and then incubated with Mito-Tracker Green (Beyotime, Nanjing, China) for 1 h at room temperature. The cell nuclei were counterstained with Hoechst 33342, and images were acquired using a fluorescence microscope.
The cells were trypsinized and resuspended in DMEM containing 1% FBS at a density of 1 × 106 cells/ml. Part of the cell suspension (100
The cells were cultured on glass coverslips and fixed in 4% paraformaldehyde in PBS for 10 min, permeabilized in 0.1% Triton X-100 in PBS for 4 min, blocked with 1% BSA/PBS for 1 h, and then incubated with rhodamine-conjugated phalloidin (Invitrogen, CA, USA) diluted 1 : 100 in a blocking solution for 1 h at room temperature. The cell nuclei were counterstained with DAPI, and images were acquired using a fluorescence microscope.
Total RNA was extracted from cultured cells using an Ultrapure RNA Extract Kit (CWBiotech, Beijing, China), and reverse transcription was performed with 1
Complementary DNA was amplified for MsrB1 detection using 5
The primers used for the RT-qPCR experiments.
Gene | Primer | Sequence |
---|---|---|
TGF- |
Forward primer | GGCCAGATCCTGTCCAAGC |
Reverse primer | GTGGGTTTCCACCATTAGCAC | |
Forward primer | CATCTACACAGTTTGATGCTGCT | |
Reverse primer | GCAGTTTTGTCAGTTCAGGGA | |
MMP-2 | Forward primer | TACAGGATCATTGGCTACACACC |
Reverse primer | GGTCACATCGCTCCAGACT | |
MMP-9 | Forward primer | TGTACCGCTATGGTTACACTCG |
Reverse primer | GGCAGGGACAGTTGCTTCT | |
MsrA | Forward primer | GAGTGGTGTACCAGCCAGAAC |
Reverse primer | GGGTCGGGTCGTGATTCTC | |
MsrB2 | Forward primer | CGGAGCAGTTCTACGTCACAA |
Reverse primer | CAGCACACGCAATGATACATTC | |
MsrB3 | Forward primer | CGGTTCAGGTTGGCCTTCATT |
Reverse primer | GTGCATCCCATAGGAAAAGTCA | |
FOXK1 | Forward primer | CAGTTACCGCTTTGTGCAGAA |
Reverse primer | CGGCTTTGACTCATCCTTGG | |
PCNA | Forward primer | CCTGCTGGGATATTAGCTCCA |
Reverse primer | CAGCGGTAGGTGTCGAAGC |
We used antibodies to detect target protein expression (see antibody above) in the LM3 and snu387 cell lines.
Western blotting was performed as follows: the transfected cell proteins were collected and stored at −80°C after being centrifuged at 12,000
Statistical analysis was performed using SPSS 17.0, and results were expressed as the mean ± standard deviation (SD). Analysis of variance was used to analyze variance among all the groups, and the potential associations between MsrB1 gene expression and clinicopathological parameters were evaluated using chi-square tests or Fisher’s exact test. Overall survival rates were calculated using the Kaplan-Meier method, and the significance of the differences between survival curves was assessed using the log-rank test. We performed independent sample
To detect MsrB1 expression in HCC tissues and paratumor tissues, we analyzed MsrB1 mRNA levels in tissue samples from 9 patients with tumor-free liver disease and 6 patients with HCC using RT-PCR. We found that MsrB1 mRNA expression was upregulated in 5 of the 6 HCC tissue samples compared with 8 of the 9 tumor-free liver disease tissue samples (Figure
Expression of MsrB1 in tissues and cell lines of HCC. (a) MsrB1 mRNA expression was elevated in 6 HCC tumors than in 9 normal liver tissues detected by RT-PCR. (b) MsrB1 mRNA expression was increased in HepG2, Hep3B, LM3, and BEL-7402 cell lines than in HL-7702 detected by RT-PCR. (c) MsrB1 mRNA expression was increased in HepG2, Hep3B, BEL-7402, BEL-7404, and BEL-7405 cell lines than in HL-7702 detected by q-PCR (
According to the results of a prognosis analysis based on IHC staining (Figure
Tissue expression of MsrB1 in HCC and its relation to survival in survival analysis. (a) MsrB1 expression level is upregulated in carcinoma (Ca) and/or paratumor (Pa) tissue. (b) Compared with patients with low expression, patients with high MsrB1 expression had worse overall survival (
The results of the IHC analysis of the relationship between MsrB1 expression levels and clinicopathological characteristics showed that MsrB1 expression was correlated with tumor size (
The relationship between MsrB1 expression levels and clinicopathological characteristics.
MsrB1 density | |||
---|---|---|---|
Variable | High | Low | |
In general | |||
Tumor tissue | 80 | 32 | |
Sex | |||
Male | 59 | 25 | 0.3 |
Female | 14 | 3 | |
Age (years) | |||
≤50 | 22 | 15 | |
>50 | 51 | 13 | |
Tumor size (cm) | |||
≤3 | 30 | 6 | |
>3 | 45 | 25 | |
AFP (ng/ml) | |||
≤400 | 40 | 13 | 0.4251 |
>400 | 30 | 14 | |
HBsAg | |||
Positive | 70 | 25 | 0.619 |
Negative | 10 | 7 | |
Liver cirrhosis | |||
Yes | 67 | 16 | |
No | 20 | 12 | |
BCLC | |||
0-B | 77 | 27 | |
C | 1 | 3 | |
TNM stage (AJCC) | |||
I-II | 72 | 29 | 0.96 |
III-IV | 8 | 3 |
MsrB1 expression levels were related to age (
We examined MsrB1 expression HCC cell lines and selected LM3 and snu387 cells as target cells to proceed with the latter experiments by qPCR and Western blotting. MsrB1 expression was silenced due to shRN-MsrB1 interference. MsrB1 expression was reduced at the protein level (Figure
MsrB1 mRNA sequence expression levels were measured in sh-MsrB1 and sh-NC snu387 cells (Figures
Stably infected LM3 and snu387 cells were cultured for 24 h, 48 h, and 72 h, and cell viability was measured using MTT assay (Figure
MsrB1 inhibits HCC cell proliferation
In the sorafenib-treated group, the cell viability percentages were 45.75%, 38.09%, and 30.14% in LM3 cells and 94.05%, 55.72%, and 57.45% in snu387 cells after 24 h, 48 h, and 72 h, respectively (Figure
HCC cell proliferation was again tested using an EdU assay, the results of which showed that the proliferation percentage of red-fluorescent cells (representing proliferation in the MsrB1-interference cell line) was lower than that of control cells (Figure
LM3 cells were used to examine HCC formation in female BALB/c nude mice. After 8 weeks, the sizes of the HCC tumors in the sh-MsrB1 group were significantly smaller than those in the sh-NC group (Figure
Using flow cytometry, we evaluated whether MsrB1-interference-induced growth inhibition in HCC cells was related to apoptosis. The rates of apoptosis were 15.58% and 2.27% and 20.9% and 12.9%, in the LM3- and snu387-cell MsrB1-interference and sh-NC groups, respectively (Figures
MsrB1 induced apoptosis and cell cycle arrest of HCC cells. (a, c) Knockdown of MsrB1 enhances H2O2/trx-induced apoptosis of LM3 cells. (b, c) Knockdown of MsrB1 enhances apoptosis of snu387 cells. (d) Mitochondrial integrity completely disappeared in HCC cells due to MsrB1 knockdown, resulting in the fragmentation of some mitochondria. (e, f) Knockdown of MsrB1 induced S/G2 phase arrest and G1 phase decrease.
While detecting apoptotic phenomena, we noted visible fluorescence indicative of a breakdown in mitochondrial integrity, especially mitochondrial membrane integrity. Mitochondrial integrity completely disappeared in HCC cells due to MsrB1 knockdown, resulting in the fragmentation of some mitochondria (Figure
Using flow cytometry, we evaluated whether cell growth inhibition caused by sh-MsrB1 was related to cell cycle arrest. We determined that sh-MsrB1 induced S/G2 phase arrest and resulted in a decreased percentage of cells in the G1 phase (Figures
Transwell assays demonstrated that sh-MsrB1 reduced migration potential to 14.66% and 24.26% compared to the controls in LM3 and snu387 cells, respectively (Figure
MsrB1 knockdown inhibited the migration of HCC cells. (a) The transwell assay demonstrated that knockdown of MsrB1 reduced the migration of HCC cells. (b) Knockdown of MsrB1 leads to cytoskeletal rearrangement and inhibition of cell adhesion and spreading of HCC cells.
There were no noticeable differences in interior actin filament stress fiber formation in MsrB1-knockdown cells compared with control cells. However, regarding exterior actin filament stress fiber formation, ruffling and pseudopodium-induced cell migration were almost completely absent in MsrB1-knockdown cells compared with control cells. These pseudopodia function as drivers in HCC cells, and their absence may explain the reductions in HCC cell migration potential demonstrated by the transwell assay (Figures
Consistent with the results of the
MsrB1 affects proliferation/migration of HCC cells by inhibition of the MAPK pathway, inducing apoptosis and inhibition of EMT. (a) The mRNA expression of MsrA/B2/B3, PCNA, FOXK1,
Furthermore, MsrB1 knockdown induced activation and cleaved PARP and caspase 3 expression levels, changes which are reflective of proliferation inhibition (Figure
EMT is essential for tumor invasion and migration in metastasis. To elucidate the mechanisms underlying this phenomenon, we examined the effects of MsrB1 knockdown on EMT by analyzing EMT-related factor expression in sh-MsrB1 cells (Figure
We also stained
Correlation analysis of
MsrB1-related gene expression | ||||
---|---|---|---|---|
MsrB1 | ||||
Positive | Negative | |||
Positive | 66 | 24 | ||
Negative | 18 | 16 | ||
P53 | Positive | 31 | 13 | |
Negative | 59 | 21 | 0.6938 | |
FOXK1 | Positive | 78 | 15 | |
Negative | 12 | 18 |
MsrB1 expression levels was related to
HCC is the fifth cancer worldwide and is currently the third-leading cause of cancer-related death, as it accounts for half a million deaths each year. Over the years, there have been many advances in the therapeutic strategies used to treat HCC in its advanced or terminal stages. However, the overall prognosis of the disease has not improved. Although surgery is a suitable therapy for HCC in the terminal stages of the disease, novel therapeutic agents, prognosis-determining methods, and, in particular, biotherapies would clearly be of great benefit with respect to HCC treatment. Therefore, identifying biological markers that can contribute to HCC biotherapy is necessary.
Molecular oxygen is indispensable for the energy pathways that occur in various cellular compartments in aerobic organisms, but oxygen utilization is also associated with ROS generation [
In the antioxidant enzymes induced by ROS, MSRs function in direct protein repair and indirect ROS scavenging. The vital cellular function of the Msr gene family entails protecting cells from oxidative damage by enzymatically reducing the oxidized sulfide groups of methionine residues in proteins from sulfoxide (-SO) back to sulfide, thus restoring normal protein function and reducing intracellular ROS levels [
Researchers have been focused on the function of MsrB1 in
Similar to the proteomic alterations observed in Msr-silenced HEK293 cells [
Tissue damage, including cell death, can result from the accumulation of high levels of free radicals in cells, which can cause oxidization and functional impairment directly or through signal transduction pathways, such as the c-Jun N-terminal kinase (JNK) and mitogen-activated protein kinase (MAPK) pathways [
Previous studies have demonstrated that MsrA overexpression protects lens cells against oxidative stress, whereas MsrA deletion renders these cells more vulnerable to oxidative stress and decreases cell viability in the absence of oxidative stress [
Regarding tumor migration and invasion, the cytoskeleton plays a major role in stimulating various processes that induce migration, including actin filament activation at the leading edge of the cell, and profilin-induced actin polymerization to propel the leading edge of the cell forward [
Regarding the mechanism underlying the above phenomena, the morphological behaviors in question are related to EMT and processes associated with tumor metastasis. EMT is essential for tumor invasion and metastasis [
One of the most important causes of poor prognoses in cancer patients is tumor cell invasion of distal organs. The complex process of metastasis requires the integration of several events, including the dissociation of cells from the primary tumor in association with local remodeling and degradation of the ECM [
In conclusion, ROS regulation is an important factor in tumor development, metastasis, and responses to anticancer therapies. ROS regulate many signaling pathways linked to tumorigenesis and metastasis, either directly or indirectly. Oxidative stress induction can lead to the preferential killing of cancer cells [
Although the targets of MsrB1 in tumors have yet to be defined, it has been shown that MsrB1 is important for the maintenance of HCC cell viability and resistance to oxidative stress. These properties of MsrB1, coupled with the presence of the protein in HCC, may indicate that the protein is associated with the repair of proteins damaged by ROS and that loss of its normal function may contribute to disease progression.
We propose that targeting enhanced antioxidant defense mechanisms may be a useful strategy for specifically killing cancer cells while sparing normal cells [
All
The authors have no conflict of interest.
The authors thank Xiaotong Hu and Yeye Kuang (Sir Run Run Shaw Hospital) for the guidance in the process of the experiment and Lanlan Zang, Lijun Peng (Linyi People’s Hospital), and Jiacheng Tang (Sir Run Run Shaw Hospital) for revising the figures and for writing and advice in the manuscript. This work was supported by the following grants: (1) the Science-Technology Projects of Zhejiang Province (LY15H160043), (2) Medicine and Health Science and Technology Development Plan of Shandong Province (2016WS0236), and (3) the Science-Technology Foundation of Shandong Province (no. ZR2016HL31).
Figure S1: compared with patients with low expression, patients with high MsrB1 expression had worse survival in database analysis (
Figure S2: the predictive mechanism of the gene of MsrB1 in GO/KEGG enrichment. (A) The interference result of sh-MsrB1 on LM3 and snu387 cells. (B) Volcano plot of MsrB1 mRNA sequence expression levels was measured in sh-MsrB1 and sh-NC snu387 cells. (C) The predictive mechanism of the gene of MsrB1 in GO enrichment. (D) The predictive mechanism of the gene of MsrB1 in KEGG enrichment.
Figure S3: MsrB1 overexpression promotes proliferation and invasion in HCC cells. (A) MsrB1 overexpression promotes proliferation in huh7 cells through the MTS assay. (B) MsrB1 overexpression promotes proliferation in BEL7402 cells through the MTS assay. (C) MsrB1 overexpression promotes proliferation in huh7 cells with sorafenib through the MTS assay. (D) MsrB1 overexpression promotes proliferation in BEL7402 cells with sorafenib through the MTS assay. (E) Transwell assay-manifested MsrB1 overexpression promotes invasion of the huh7 cell. (F) Transwell assay-manifested MsrB1 overexpression promotes invasion of the BEL7402 cell. (G) Western blot indicated the different expression of MsrB1 in HCC cells with the pCMV-MsrB1 vector.