Allylmethylsulfide (AMS) is a novel sulfur metabolite found in the garlic-fed serum of humans and animals. In the present study, we have observed that AMS is safe on chronic administration and has a potential antihypertrophic effect. Chronic administration of AMS for 30 days did not cause any significant differences in the body weight, electrocardiogram, food intake, serum biochemical parameters, and histopathology of vital organs. Single-dose pharmacokinetics of AMS suggests that AMS is rapidly metabolized into Allylmethylsulfoxide (AMSO) and Allylmethylsulfone (AMSO2). To evaluate the efficacy of AMS, cardiac hypertrophy was induced by subcutaneous implantation of ALZET® osmotic minipump containing isoproterenol (~5 mg/kg/day), cotreated with AMS (25 and 50 mg/kg/day) and enalapril (10 mg/kg/day) for 2 weeks. AMS and enalapril significantly reduced cardiac hypertrophy as studied by the heart weight to body weight ratio and mRNA expression of fetal genes (ANP and
Cardiovascular diseases (CVDs) contribute the highest among the noncommunicable disease’s deaths globally; nearly 17.8 million deaths were reported due to CVDs alone in the year 2017 [
The extracellular matrix (ECM) of the adult myocardium hosts both cardiomyocytes and interstitial cells in a complex three-dimensional orientation. ECM in addition to mechanical support also serves as a reservoir of growth factors to maintain basal physiology. During myocardial stress, homeostasis of the ECM is perturbed, resulting in systolic and diastolic dysfunctions due to compromised signal transduction [
Several attempts have been made to inhibit ECM remodeling by inhibiting MMPs in the diseased heart and thereby reduce heart failure [
Nutraceutical properties of the garlic against various complications are documented in ancient scriptures. Both prophylactic and therapeutic effects of garlic were promising in cardiometabolic complications [
Earlier, we have reported the promising cardiometabolic properties of garlic [
Isoproterenol (isoprenaline) is a synthetic nonspecific beta-adrenergic receptor agonist. Sustained release of isoproterenol induces cardiac hypertrophy followed by myocardial remodeling and ultimately leading to heart failure [
In our previous study, we have reported the antihypertrophic effect of AMS on cardio myoblast [
Male Sprague Dawley Rats of 200-250-gram weight were procured form the National Institute of Pharmaceutical Education and Research (Mohali, India). All animal studies were performed in accordance with the standard operating procedures of the Translational Health Science and Technology Institute (THSTI) and with Institutional Animal Ethical Committee (IAEC/THSTI/2015-4) approval, Faridabad. Animals were housed in a small animal facility of THSTI, maintained at a
Fifty-six animals were randomly divided into seven groups (
Forty animals were randomly divided into five groups (
For safety study, 0.5 ml of virgin corn oil (Group 2), freshly prepared garlic homogenate 250 mg/kg/day along with 0.5 ml of corn oil (Group 3), and AMS 25, 50, 100, and 200 mg/kg (Groups 4, 5, 6, and 7) dissolved in 0.5 ml of corn oil were administered orally for 30 days. For efficacy study, 0.5 ml of corn oil was orally administered as vehicle in three groups (Group 1, Group 2, and Group 5) while AMS (25 and 50 mg/kg/day) dissolved in 0.5 ml was orally administered in two groups (Groups 3 and 4). Group 5 received 10 mg/kg of enalapril orally.
Rats were anesthetized in supine position by gaseous anesthesia (isoflurane 2%) coupled with a 100% oxygen supply. The core body temperature of the animal was maintained at 37°C by a controlled heating pad (Homeothermic Blanket Control unit, Harvard Apparatus®). As per the manufacturer’s instructions, 15 minutes of ECG was recorded to each animal on Power Lab 26T (ADInstruments, Australia) and the acquired data was analyzed on LabChart 8 software.
Safety study animals were subjected to retroorbital bleeding under gaseous anesthesia. Blood samples were kept at room temperature for 1 hr followed by centrifugation at 3,000 g for 30 minutes at 4°C. Serum glutamic oxaloacetic transaminase (SGOT), serum glutamic pyruvic transaminase (SGPT), creatinine kinase-myocardium bound (CK-MB), and alkaline phosphatase were measured by a semi autoanalyzer.
To study the pharmacokinetics of AMS, SD rats were used. AMS 100 mg/kg single dose was administered orally, and subsequently, blood samples were collected at 0, 0.25, 0.5, 1, 2, 4, 8, 12, 24, 36, and 48 hrs. Post 30 minutes of sample collection, serum was separated by centrifugation at 600 g for 20 minutes at 4°C and stored at -80°C for further analysis.
For sample preparation, 100
For standard curve, AMS (Cas. No. 10152-76-8, Sigma-Aldrich), AMSO (Cas. No. 21892-75-1, EPTES, Food and Flavor Analytical), and AMSO2 (Cas. No. 16215-14-8, Sigma-Aldrich) were spiked in control serum and the earlier mentioned extraction procedure was followed. All data were acquired on the orbitrap fusion mass spectrometer equipped with a heated electrospray ionization (HESI) source. Data were acquired on a positive mode at 120,000 resolution in full-scan MS1. We used a spray voltage of 4000 for positive. Sheath gas and auxiliary gas were set to 42 and 11, respectively. The mass scan range was 50-500 m/z, AGC (automatic gain control) target at 400000 ions, and the maximum injection time was 200 ms for MS. Extracted metabolites were separated on UPLC ultimate 3000 using an HSST3 column (
All acquired data has been processed using Progenesis QI for metabolomics (Waters Corporation) software using the default setting. The untargeted metabolomics workflow of Progenesis QI was used to perform retention time alignment, feature detection, deconvolution, and elemental composition prediction. Identification of metabolites has been done based on the match of accurate mass and the retention time of purchased standards. Relative intensity of the corresponding metabolites has been used for quantification. PKSolver a freely available add-in program for Microsoft Excel was used for pharmacokinetic parameters as mentioned [
Isoproterenol (~5 mg/kg/day) prepared in 0.001% ascorbic acid solution was delivered by ALZET® osmotic minipump (model #2002) as per the manufacturer’s instructions. Briefly, rats were anesthetized with gaseous anesthesia (isoflurane 2%) coupled with a 100% oxygen supply. The core body temperature of the animal was maintained at 37°C by a controlled heating pad (Homeothermic Blanket Control unit, Harvard Apparatus®). Hairs on the dorsal side below the neck are removed by depilatory cream, and a small incision is made to accommodate the sterile minipump charged with isoproterenol solution subcutaneously. Finally, 4-0 silk sutures are used to close the incision. Control animals received osmotic minipump filled with 0.001% ascorbic acid alone. Finally, povidone-iodine ointment was applied until complete wound healing is achieved. Minipump (model 2002) dispenses 0.5
Lipid peroxidation in the myocardium was measured by the protocol described by Ohkawa et al. [
Reduced glutathione in the myocardium was measured by Ellman’s method [
Myocardial catalase was estimated by the method as described by Aebi [
Total superoxide dismutase activity is measured as per the manufacturer’s protocol using the Sigma-Aldrich (19160-1KT-F) kit.
Approximately 50 mg of myocardial tissue is homogenized in 1 ml of RIPA buffer containing (1x) protease and phosphatase inhibitors. The homogenate is centrifuged at 13,500 g for 20 min at 4°C. Protein concentration in the supernatant is measured by the the bicinchoninic acid assay method (Thermo Scientific). Sample preparation is done in Laemmli buffer using an equal amount of protein. For electrophoresis, protein is resolved on 10% SDS-polyacrylamide gel prepared by the TGX stain-free kit (Bio-Rad). Methanol-activated 0.2
The specific HRP-labelled secondary antibody is incubated at room temperature for 60 min. Further, the membrane is washed with TBST thrice and finally, the signal is recorded using the Gel Doc XR system (Bio-Rad) with West Dura Pico kit (Thermo Scientific). The following antibodies were used in the study: beta MHC (Abcam; ab50967), MnSOD (Abcam; ab137037), catalase (Abcam; ab52477), caspase 3 (Cell Signaling; 9665), caspase 7 (Cell Signaling; 12827), caspase 9 (Cell Signaling; 9508), MMP2 (Abcam; ab86607), MMP9 (Abcam; ab38898), TIMP3 (Cell Signaling; 5673), and GAPDH antibody (Cell Signaling; 2118). Measured protein expression was normalized to GAPDH as a housekeeping protein.
Total RNA was isolated from the left ventricular tissue by TRI reagent (Sigma-Aldrich) as per the manufacturer’s protocol. The purity and concentration of RNA were measured by a NanoDrop spectrophotometer (Thermo Scientific). Following DNase treatment, reverse transcriptase reaction was performed by SuperScript-III Reverse Transcriptase (Takara, USA) for cDNA synthesis from 2
Primers used in RT-PCR analysis.
Gene | Forward primer | Reverse primer |
---|---|---|
ANP | AGCGAGCAGACCGATGAAGG | AGCCCTCAGTTTGCTTTTCA |
Beta MHC | TGGAGCTGATGCACCTGTAG | ACTTCGTCTCATTGGGGATG |
RPL32 | AGATTCAAGGGCCAGATCCT | CGATGGCTTTTCGGTTCTTA |
Immediately after sacrifice of the whole heart, kidney and liver tissues were excised and cleaned with ice-cold PBS to remove blood clot. Histopathology samples were stored in freshly prepared 10% phosphate-buffered formalin. Masson’s trichrome and haematoxylin-eosin stains were used to stain 5
The rat cardio myoblast (H9c2) cell line was procured from ATCC® (USA) and was cultured in Dulbecco’s Modified Eagle Media, (Cat. No. SH30243.01, HyClone™, GE Life Sciences) containing (4 mM L-glutamine and 45000 mg/L glucose and sodium pyruvate) and supplemented with 10% Fetal Bovine Serum (Cat. No. SH30071.03, HyClone™, GE Life Sciences). Cell culture was maintained at 37°C in a 5% CO2 incubator (HERACELL VIOS 160I, Thermo Scientific). For flow cytometry and confocal imaging, 0.2% ethanol was added to the control group. The hypertrophy group was treated with 10
Intracellular ROS is measured by BD FACSCanto™ II (BD Biosciences, US). Briefly, following 72 hrs of earlier mentioned treatments, 10
For immunostaining, we followed the previously described protocol [
H9c2 cardio myoblasts were grown on a glass coverslip and treated with the abovementioned doses for 72 hrs. Caspase 3/7 green fluorescent reagent (Cat. No. C10423, CellEvent™, Invitrogen) is a four-amino acid peptide (DEVD) attached to a nucleic acid-binding dye with absorption/emission maxima of ~502/530 nm. Activated caspase 3/7 will cleave the DEVD peptide sequence and allow it to bind with the nucleic acid and produce a green signal. Following treatments, 5
In vitro AMS toxicity is determined by methyl thiazolyl tetrazolium (MTT) assay. Briefly, cardio myoblasts (10,000 cells/well) were seeded in each 96 well plate to attain a 60-70% confluency. Further, AMS dose range (100 nm to 500
Data in the present study is reported as the
To study the pharmacokinetics of AMS, a single dose of 100 mg/kg was administered orally. We have observed that AMS is rapidly metabolized into AMSO and AMSO2 in the physiological system. To measure the exact concentration of AMSO and AMSO2 in the serum, peak intensity of the metabolites was extrapolated to the standard curve of the same, respectively (Figures
Effect of Allylmethylsulfide on pharmacokinetic parameters. (a) Standard curve of Allylmethylsulfoxide (AMSO). (b) Standard curve of Allylmethylsulfone (AMSO2). (c, d) Concentration vs time graph of AMSO and AMSO2. (e) Cumulative representation of graphs c and d. (f) Pharmacokinetic parameters of AMSO and AMSO2. Maximum serum concentration (
To evaluate the effect of chronic administration of AMS, we have measured the body weight of the animals at every week from the beginning of AMS intervention till 4 weeks. We did not observe any significant change in the body weight in any of our treatment groups (Figure
Effect of Allylmethylsulfide on the (a) body weight, (b) food intake, (c) heart weight to tail length ratio, and (d) electrocardiogram (ECG) parameters. Data were represented as
To study the effect of AMS on histopathology of vital organs such as the heart, liver, and kidney, we have stored the tissues immediately after the euthanasia and stained it with MT and H&E stain. We did not observe any structural difference between any of the treatment groups (Figures
Effect of AMS on histopathology. (a) Transverse section of the heart representing the ventricular diameter. (b, c) Masson’s trichrome staining of the heart tissue representing interstitial and perivascular fibrosis, respectively. (d–f) Haematoxylin and eosin stain of the heart, kidney, and liver.
Isoproterenol-induced cardiac hypertrophy was measured by the heart weight to body weight (HW/BW) ratio at the end of 14 days of AMS cotreatment. We have noticed there is a significant increase in the HW/BW ratio in the diseased group, while with the AMS and enalapril treatment, it was reduced (Figure
Effect of AMS on cardiac hypertrophy markers. (a) Heart weight to body weight ratio. (b) mRNA expression of atrial natriuretic peptide (ANP). (c) mRNA expression of beta myosin heavy chain (
We next decided to study the effect of AMS on lipid peroxidation and endogenous antioxidants. Isoproterenol induced a significant increase in the MDA levels as measured by TBARS, and with the AMS (25 and 50 mg/kg/day) and enalapril treatment, it was reduced significantly (Figure
Effect of AMS on biochemical parameters and endogenous antioxidants. (a) Thiobarbituric acid reactive substances (TBARS). (b) Reduced glutathione (GSH). (c) Catalase activity. (d) Super oxide dismutase activity (SOD). (e) Representative western blot images of MnSOD, catalase, and GAPDH. (f) Densitometric analysis of manganese superoxide dismutase (MnSOD). (g) Densitometric analysis of catalase expression. Protein expression data were normalized with the reference protein expression, GAPDH. Data were expressed as
To corroborate the results of the
During isoproterenol-induced cardiac hypertrophy, homeostasis of extracellular matrix is perturbed and may result in the activation of matrix metalloproteinases (MMPs). We have observed a significant increase in the protein expression of MMP2 in the hypertrophic group, and with AMS (50 mg/kg/day) and enalapril treatment, it was reduced significantly (Figures
Effect of AMS on extracellular matrix components. (a) Representative western blot images of caspase matrix metalloproteinases (MMPs 2 and 9), tissue inhibitor of matrix metalloproteinase 3 (TIMP3), and GAPDH. (b, c) Densitometric analysis of MMPs 2 and 9. (d) Densitometric analysis of TIMP3. Protein expression data were normalized with the reference protein expression, GAPDH. Data expressed as
We have studied the protein expression of proapoptotic caspases in the hypertrophic heart. We have observed that isoproterenol-induced hypertrophic hearts showed increased expression of caspase 3 (Figure
Effect of AMS on caspases. (a) Representative western blot images of caspase 3, caspase 7, caspase 9, and GAPDH. (b–d) Densitometric analysis of caspases 3, 7, and 9. Protein expression data were normalized with the reference protein expression, GAPDH. Data were expressed as
To corroborate our in vivo finding, we decided to check the effect of AMS on the nuclear expression of caspase 3/7 in isoproterenol-treated H9c2 cells. We have noticed that there was a significant increase in the green fluorescence of caspase 3/7 in the nuclear portion of isoproterenol-treated cells. However, these signals were reduced in the AMS-cotreated isoproterenol cells (Figures
Effect of AMS on caspase 3/7 expression in H9c2 cardio myoblast (a) Representative confocal images of caspase 3/7 expression in the nucleus. (b) Nuclear staining by DAPI. (c) Merged images of DAPI and caspase 3/7. (d) Representative bar graph of mean fluorescence intensity. Data were expressed as
We did histopathology study to check the effect of increased protein expression of matrix metalloproteinases on fibrosis. Gross investigation of the left ventricular diameter showed the presence of hypertrophy in the isoproterenol group; however, with AMS treatment, we have seen a decrease in the diameter and muscle thickness (Figure
Effect of AMS on isoproterenol-induced hypertrophic heart. (a) Gross transverse section of the heart representing ventricular diameters. (b, c) Haematoxylin and eosin staining of the heart representing neutrophil infiltration in interstitial and perivascular, respectively. (d, e) Masson’s trichrome staining of the heart representing interstitial and perivascular fibrosis.
Both prophylactic and therapeutic effects of garlic in the past have documented numerous promising results. Previously, we have identified that AMS is an active metabolite of garlic and showed a reduction in the cell size
Furthermore, after safety and pharmacokinetic studies, we looked the effect of AMS in the rodent model of cardiac hypertrophy. Isoproterenol-induced cardiac hypertrophy upregulates mRNA expression of fetal genes (ANP and
We next thought to corroborate the
Fibrosis develops due to excessive accumulation of collagen and other ECM components by the differentiation of fibroblast into myofibroblast. Based on the nature of pathological insult, the three types of cardiac fibrosis that develop are reactive interstitial fibrosis, infiltrative interstitial fibrosis, and replacement fibrosis [
Cardiac fibroblast plays a pivotal role in the ECM homeostasis. The major components of ECM include collagen I, collagen III, fibronectin, laminin, and elastin. ECM maintains the structural integrity of cardio myocytes, fibroblast, and coronary arteries within the myocardium and also maintains the electrical signal conduction for rhythmic contractility of the heart. The integrity of the ECM components is mainly regulated by matrix metalloproteinases (MMPs) and their tissue inhibitors (TIMPs) produced by fibroblasts [
Cardiac fibrosis resulting from MMP expression was observed in the isoproterenol-induced hypertrophic heart and may lead to cardiomyocyte death, i.e., apoptosis. To investigate the effect of AMS on apoptosis, we have studied the protein expression of caspases. Pathological enlargement of the myocardium with isoproterenol results in activation of programmed cell death, compromised contractile function, and eventually heart failure [
In the present study, we have demonstrated that AMS is a safe molecule in rats. The pharmacokinetic study showed that AMS results into two stable metabolites, i.e., AMSO and AMSO2 in the physiological system. AMS reduced cardiac hypertrophy markers such as fetal gene expression and improved endogenous antioxidants. Isoproterenol-induced cardiac fibrosis and dysregulated ECM deposition in the myocardium were reduced with AMS and enalapril treatment. The only limitation of the efficacy study is that we could not measure the functional parameters of the heart by echocardiography. Overall, our study confirms that AMS is a safe and efficacious molecule for the prevention of cardiac hypertrophy and associated remodeling.
The data used to support the findings of this study are available from the corresponding author upon request.
All animal studies were approved by the Institutional Animal Ethical Committee (IAEC) of the Translational Health Science and Technology Institute, Faridabad (IAEC/THSTI/2015-4).
The authors declare no conflict of interest.
S.A.M and B.P have performed the animal studies. S.A.M and B.P carried out dosing, biochemical, gene and protein estimation, and analysis of results. U.T performed
The authors are grateful to the Indian Council of Medical Research (ICMR) and Council of Scientific and Industrial Research (CSIR) for providing research fellowship to S.A.M and B.P, respectively. This study was supported by the Translational Health Science and Technology Institute core fund. The authors are thankful to Dr. Md. Jahangir Alam and Mr. Sonu for their assistance in the pharmacokinetic study.
Figure S1: effect of Allylmethylsulfide on serum biochemical parameters. (a) Serum glutamic oxaloacetic transaminase (SGOT). (b) Serum glutamic pyruvic transaminase (SGPT). (c) Creatinine kinase-myocardium bound (CK-MB). (d) Alkaline phosphatase. Data are represented as