Hypertrophic obesity inhibits activation of peroxisome proliferators-activated receptor gamma (PPAR
White adipose tissue is constituted by different cellular types including preadipocytes, mature adipocytes, fibroblasts, pericytes, macrophages, neutrophils, lymphocytes, endothelial cells, and Adipose Stem Cells (ASCs). The balance between these different cell types and their expression profile is closely related to maintenance of the organ metabolic function [
Adipocytes produce a variety of molecules biologically active including interleukins, tumor necrosis factor-alpha (TNF-
Obesity is a chronic condition defined by an excess amount body fat; it is no longer considered to be a cosmetic problem but a risk factor for several metabolic disorders [
The uncontrolled hypertrophy of adipose tissue is characterized by the infiltration of macrophages, prominent source of proinflammatory cytokines, such as TNF-
The transition from undifferentiated fibroblast-like preadipocytes into mature adipocytes constitutes the adipocyte life cycle, and treatments that regulate both size and number of adipocytes may provide a better therapeutic approach for treating obesity.
Current studies on obesity focus on discovering plant active components that have the capability to suppress the differentiation of mesenchymal stem cells (MSCs) and preadipocytes into hypertrophic adipocytes. Recent studies reported that Caffeic Acid Phenethyl Ester (Cape), isolated from propolis, a honeybee hive product, suppresses 3T3-L1 murine cells differentiation into adipocytes [
Additionally, it has been demonstrated that Cape completely blocks production of ROS and xanthine oxidase system (XO) and also reduces malondialdehyde level secondary to polyunsaturated fatty acid oxidation [
Despite some data demonstrating that Cape inhibits murine preadipocyte differentiation, its anti-inflammatory effects on human ASCs adipocyte differentiation and hypertrophic adipocytes are not known. The aim of this study is to investigate the molecular mechanism of Cape, a strong antioxidant, to prevent adipogenesis but also to restore the function of inflamed mature adipocytes.
Subcutaneous adipose tissue sample was obtained from a healthy patient that underwent abdominal plastic surgery (male, 23 years old, 98 kg b.w.); the subject provided his written consent before inclusion in the study. Since this is a nontherapeutic trial, it was carried out with the consent of the subject legally acceptable according our Italian Government (Legge 675/1996 and DL 196/2003, art. 40. Art 32 Codice Italiano di Deontologia Medica).
Adipose tissue was minced with scissors and scalpels into less than 3 mm pieces and isolation of ASCs proceeded as previously described [
The phenotype of ASCs was evaluated by flow-cytometry analysis (FC500 Beckman Coulter). The ASCs presented as a homogeneous fibroblastic cell population. Flow cytometric analysis of passage 4th cells revealed that cells were negative for CD34 and CD45 and that cells were positive for CD105 and CD90.
ASCs (passages 4 to 5) were plated in a 75 cm2 flask at a density of 1 to 2 × 104 cells and cultured in DMEM with 10% FBS for 7 days. The medium was replaced with adipogenic medium, and the cells were cultured for additional 14 or 21 days.
The adipogenic media (Lonza, Basel, SW) consisted of complete culture medium supplemented with DMEM-high glucose, 10% (v/v) FBS, 10
Determination of ROS was performed by using a fluorescent probe 2′,7′-dichlorofluorescein diacetate (DCFH-DA). The fluorescence (corresponding to the oxidized radical species 2′,7′-dichlorofluorescein (DCF)) was monitored spectrofluorometrically (excitation,
Staining was performed using 0.21% Oil Red O in 100% isopropanol (Sigma-Aldrich, St. Louis, MO, USA). Briefly, adipocytes were fixed in 10% formaldehyde, stained with Oil Red O for 10 minutes, and rinsed with 60% isopropanol (Sigma-Aldrich), and the Oil Red O was eluted by adding 100% isopropanol for 10 minutes, and the optical density (OD) was measured at 490 nm, for 0.5 sec reading. Nuclei were stained with NucBlue (Life Technologies, NY). Lipid droplets accumulation was examined by using inverted multichannel LED fluorescence microscope (Evos, Life Technologies, NY).
RNA was extracted by Trizol reagent (Invitrogen, Carlsbad, CA, USA). First strand cDNA was then synthesized with Applied Biosystem (Foster City, CA, USA) reverse transcription reagent.
Quantitative real-time PCR was performed in 7900HT Fast Real-Time PCR System Applied Biosystems using the SYBR Green PCR MasterMix (Life Technologies). The primer sequences used are shown in Table
PCR primers used in this study.
Gene | Primer forward | Primer reverse |
---|---|---|
Adiponectin | AGGCTTTCCGGGAATCCAAG | CGCTCTCCTTCCCCATACAC |
CEBP |
TAACTCCCCCATGGAGTCGG | ATGTCGATGGACGTCTCGTG |
DGAT1 | CGCGGACTACAAATGGACGA | AACCAGTAAGACCACAGCCG |
DLK1 | TCCTCAACAAGTGCGAGACC | CTGTGGGAACGCTGCTTAGA |
FABP4 | AAACTGGTGGTGGAATGCGT | GCGAACTTCAGTCCAGGTCA |
FAS | CGGAGGCATCAACCCAGATT | GATGGTGGTGTAGACCTTCCG |
GAPDH | AGACACCATGGGGAAGGTGA | TGGAATTTGCCATGGGTGGA |
HO-1 | GTGCCACCAAGTTCAAGCAG | CACGCATGGCTCAAAAACCA |
ICAM1 | TCTTCCTCGGCCTTCCCATA | AGGTACCATGGCCCCAAATG |
IL1 |
CCAAACCTCTTCGAGGCACA | AACACGCAGGACAGGTACAG |
IL6 | CTTCTCCACAAGCGCCTTCG | CTGGCATTTGTGGTTGGGTC |
IL8 | GGTGCAGTTTTGCCAAGGAG | TTCCTTGGGGTCCAGACAGA |
IRS1 | GCAACCAGAGTGCCAAAGTG | AGGTCATTTAGGTCTTCATTCTGCT |
LEPTIN | TCACACACGCAGTCAGTCTC | AGCTCAGCCAGACCCATCTA |
ME1 | CGGAACCCTCACCTCAACAA | AGAGACCTCTTGGCTTCCGA |
NF |
TCGGGACTTTCCTAAGCTGC | GAGAGCGAGATCCGGAGTTG |
PPAR |
AAGAGCTTGGAGCTCGGC | TGAAAGCGTGTCCGTGATGA |
PPAR |
AGAGTACGTGGGAGAAATGAC | GATGGCCACCTCTTTGCTCT |
PPAR |
GGGACAGGCTGATGGGAAC | TGAACACCGTAGTGGAAGCC |
SCD | CTTGCGATATGCTGTGGTGC | CCGGGGGCTAATGTTCTTGT |
SIRT1 | TGATTGGCACAGATCCTCGAA | AAGTCTACAGCAAGGCGAGC |
SREBP-1c | CCCCACTTCATCAAGGCAGA | GCTGTGTTGCAGAAAGCGAA |
TNF |
CTCGAGTCAGATCATCTTCTCGCACCCCG | GGAATTCTGTTCGTCCTCCTCACAGGGC |
Statistical significance (
ASCs were obtained from human adipose tissue and were cultured in adipocyte-induced medium. Confirmation of the ASC phenotype was made by the presence of positive markers measured by FACS: 97.4% of the cells were positive for CD105 (Figure
Determination of ASCs phenotype. Membrane antigen expressions of CD45, CD34, CD90, and CD105 on ASCs were analyzed by FACS analysis. As negative markers, CD45 (common lymphocytes antigen) and CD34, an hematopoietic stem cell marker, were shown to be low expressed.
To investigate signals that might regulate the differentiation of ASCs, we first conducted a time course study focusing on days 0, 7, 18, and 21 of adipogenesis.
The mRNA levels of PPAR
Expression of adipogenic markers during adipogenesis. qRT-PCR revealed a marked increase of PPAR
Expression of adipogenic markers and cytokines levels during adipogenesis. qRT-PCR revealed a marked increase of DLK1, SREBP-1c, DGAT1, adiponectin, leptin, and TNF
Similarly, adiponectin expression was reduced in 21-day differentiated adipocytes while leptin and TNF
The increase of lipid droplets mirrored the increase in triglycerides accumulation consequence of increased levels of DGAT1 mRNA levels (Figure
In another set of experiments, we examined the effect of Cape on lipid accumulation after 14 days, using standard culture conditions by measuring Oil Red O-stained lipid droplet area (Figure
The effect of Cape on differentiation. (a) Lipid droplets area was determined by Oil red O staining after 14 days. (b) Intracellular oxidants in undifferentiated, differentiated untreated, and treated cells for 14 days with Cape (10
To investigate the effects of Cape on functionality of fully differentiated adipocytes, we measured several adipogenic markers. ASCs isolated from the subcutaneous adipose tissue of a human donor were exposed to Cape only at the end of differentiation for 3 days. Our results show that Oil Red O staining was decreased after Cape treatment compared to untreated ASCs-derived adipocytes (Figure
Pictures of lipid droplets of a representative sample in the absence or presence of Cape. Adipogenesis was measured as the relative absorbance of Oil Red O at day 21 after inducing adipogenesis as described in materials and methods (mean ± SD,
Effect of Cape on cytokines and adipogenic markers. Gene levels are expressed as fold of increase compared to the respective control. Cape was added once after 18 days of differentiation at the concentration of 10
To analyze the effect of LPS on inflammation and glucose metabolism in fully differentiated adipocytes, we treated cells with LPS (1 ng/mL) for 6 hr.
Our results show that Oil Red O staining quantification was decreased after LPS treatment compared to untreated ASCs-derived adipocytes (Figure
Effect of Cape (10
These observations suggest that LPS causes induction of insulin resistance, inflammation, and lipolysis of triglycerides stored in adipocytes.
The subcutaneous adipose tissue (SAT) is the largest adipose tissue depot in humans but its ability to expand is limited and, when its storage capacity is exceeded, fat is stored in other metabolically more harmful ectopic lipid depots, such as liver, myocardium, and skeletal muscles [
Several clinical studies have shown that hypertrophic, rather than hyperplastic, obesity is associated with insulin resistance and dyslipidemia [
This study documents a novel prospective on functional adipogenesis that appears to play a central role in providing adipose tissue insulin sensitivity and functionality and in preventing the development of insulin resistance and type II diabetes.
ASCs were isolated from a patient’s adipose tissue and, differently from the murine immortalized cell line 3T3, represent a primary culture with a high clinical value for their multipotent properties suitable for tissue engineering and regenerative medical applications.
To investigate the effects of Cape on human adipocyte differentiation, ASCs isolated from the subcutaneous adipose tissue of a human donor were exposed to Cape added to the differentiation medium for 14 days. ASCs accumulated lipid droplets following exposure to the differentiation medium; however, consistent with previous reports on murine cells, adipocyte differentiation, in the presence of Cape, was reduced compared to untreated cells [
To investigate the activation of the genetic program leading to the adipocyte phenotype, mRNA expression levels of gene involved in glucose and lipid metabolism were assessed.
ASCs from the subcutaneous adipose tissue were analyzed at baseline, 7 days, 18 days, and 21 days after induction of adipocyte differentiation.
A good metabolic regulation requires finely balanced control of the capacity of adipose tissue to store and metabolize lipids, responsive to the types and quantity of substrates available.
After 21 days of differentiation, fatty acid synthesis is significantly decreased compared to day 18th as reflected by the reduction of SREBP, FAS, ME1, and SCD mRNA levels. At the same time-point, adipocytes display a reduction of beta-oxidation, evidenced by a twofold of decrease of PPAR
Adipocyte enlargement due to increased accumulation of triglycerides is associated with an increase in the levels of the proinflammatory cytokine TNF
On the other hand, smaller and not hypertrophic adipocytes are considered to be healthy, functional, and insulin-sensitive adipocytes capable of producing adiponectin [
The expression of preadipocyte factor-1 (DLK1) was decreased during differentiation, but Cape treatment prevented its downregulation and markedly increased the mRNA levels.
This is an interesting finding because the protein encoded by this gene has been shown to inhibit maturation and lipid synthesis in preadipocytes [
As previously reported, PPAR
The improvement in insulin sensitivity, induced by Cape treatment, restored the activity of the transcriptional factor SREBP-1c and the capacity to synthetize fatty acids. It is noteworthy that the elevated levels of leptin observed at day 21 may represent an adaptive response to the decreased levels of adiponectin. Leptin and adiponectin are both anti-inflammatory cytokines released by the adipose tissue but with different target and timing. Only healthy and not inflamed adipocytes produce adiponectin while the pick of leptin is reached by mature hypertrophic adipocyte, as we have shown in our results.
A physiological increase of leptin levels stimulates in the hypothalamus a specific signaling cascade that results in the inhibition of several orexigenic neuropeptides, while stimulating several anorexigenic peptides. Obese patients have high plasma leptin concentrations related to the size of adipose tissue, but the elevated leptin production does not induce the expected responses (i.e., a reduction in food intake and an increase in energy expenditure).
This phenomenon suggests that obese patients are resistant to the effects of endogenous leptin [
When substrates are present in excess, the adipocytes must respond to prevent detrimental accumulation of lipids and the resulting insulin resistance in other tissues. At a molecular level, adipocytes have the ability to synthetize and oxidize fatty acids and to accumulate them as triglycerides. The major physiological role for white adipose tissue fat stores is to supply lipid energy when it is needed by other tissues; this is achieved by a highly regulated pathway whereby the triglycerides stored in the adipocyte are hydrolyzed, and fatty acids are delivered to plasma. Treatment with Cape restores the lost balance between fatty acid synthesis, triglycerides synthesis, lipolysis, and beta-oxidation. A potential player in the relationship between inflammation and insulin resistance is SIRT1 [
Lipopolysaccharide (LPS) plays pivotal roles in obesity-associated inflammation [
The present experiments were therefore performed to assess the LPS-induced effects on lipid metabolism in human ASC-derived mature adipocytes.
LPS has been reported to induce nuclear factor-
The mRNA levels of PPAR
Our
It is well-established that not all obese patients are insulin resistant and
Proposed mechanisms demonstrating the role of Cape in the regulation of ASCs lipid metabolism via induction of PPARs and adiponectin. Cape restores the function of hypertrophic adipocytes by decreasing inflammatory cytokines and increasing insulin sensitive genes.
Adipose Stem Cells
Peroxisome proliferator-activated receptor gamma
CCAAT/enhancer binding protein alpha
Fatty acid binding protein 4
Sterol regulatory element binding transcription factor 1
Malic enzyme
Stearoyl-Coa desaturase-1
Fatty acid synthase
Sirtuin 1
Insulin receptor substrate 1
Intercellular adhesion molecule 1
Tumor necrosis factor alpha.
The authors declare that there is no conflict of interests regarding the publication of this paper.