Tissue regeneration using human adipose derived mesenchymal stem cells (hASCs) has significant potential as a novel treatment for many degenerative bone and joint diseases. Previous studies have established that age negatively affects the proliferation status and the osteogenic and chondrogenic differentiation potential of mesenchymal stem cells. The aim of this study was to assess the age-related maintenance of physiological function and differentiation potential of hASCs in vitro. hASCs were isolated from patients of four different age groups: (1) >20 years (
Mesenchymal stem/stromal cells (MSCs) hold great promise as a novel therapeutic option for use in tissue regeneration. Because of their multilineage differentiation capacity, MSCs are considered as a potential therapeutic tool for treating a wide range of pathologies, especially bone and cartilage disorders such as osteoarthritis, osteoporosis, and osteonecrosis [
Beside proliferative and multilineage differentiation potential, MSCs have an immunomodulatory effect that is dependent on cell-cell contact or mediated through the secretion of immunosuppressive molecules [
In humans, the most common disease of the joints is osteoarthritis (OA) [
Studies conducted over the past few years have suggested that aging impacts various MSC properties [
In order to draw a conclusion on the age-related maintenance of physiological function and differentiation potential of human ASCs in vitro, this study assessed several parameters: the number of fibroblasts colony forming unit (CFU-F), proliferation rate, population doubling time (PDT), and quantified parameters per lineage for osteogenic, adipogenic, and chondrogenic differentiation. This allowed us to further address a possible interdependence between viability and osteogenesis, adipogenesis, and chondrogenesis of MSCs.
To study the influence of age on the viability, morphology, and in vitro differentiation potential of human ASCs (hASCs) cells, the cells from individuals >20, >50, >60, and >70 years old were investigated. Mesenchymal stem cells were characterized for proliferation rate and CFU-F, along with measurements of population doubling time (PD), superoxide dismutase (SOD) activity, cellular senescence, apoptosis, and differentiation potential.
In subsequent experiments, cells were recruited and divided into four groups based on the donor’s age, both male and female healthy subjects (the number of males and females was equal): (1) >20 years (mean age
All cell handling procedures described herein were performed in accordance with the ethical standards laid down in the 1964 Declaration of Helsinki and its later amendments and were approved by the Local Bioethics Committee of Wroclaw Medical University (registry number KB-177/2014). Written, informed consent for using tissue samples for research purposes was obtained from each and every patient prior to surgery.
Human mesenchymal stem/stromal cells were isolated from subcutaneous adipose tissue. Patients’ fat biopsies (patient age ranged from 22 to 77 years) were obtained during total hip/knee arthroplasty or other open procedures connected with fracture reduction and fixation. Samples were placed in Hanks’ balanced salt solution (HBSS) (Sigma-Aldrich, Germany) and transferred to the laboratory. According to a standard protocol [
Cells were maintained at constant conditions in an incubator (37°C, 5% CO2 and 95% O2) throughout the experiment. The primary culture was plated in a T-25 culture flask and cultured on Dulbecco’s Modified Eagle’s Medium (DMEM, Sigma-Aldrich, Germany) with nutrient F-12 Ham, 10% of Fetal Bovine Serum (FBS, Sigma-Aldrich, Germany), and 1% antibiotic solution and then transferred to a culture flask. The primary hASC culture was designated “passage 0.” The culture medium was changed every three days until the cells reached approximately 80% confluence. Adherent cells were detached from the flask using TrypLE
For chondrogenic, osteogenic, and adipogenic differentiation experiments, hASCs were cultured in STEMPRO® Adipogenic, Osteogenic and Chondrogenic Differentiation Kits (STEMPRO, Life Technologies, Poland).
The test cells were maintained in 24-well plates and inoculated at concentration of 30 × 103 cells per well. The media was changed every two days. Chondrogenic and osteogenic stimulation was conducted for 21 days, whereas cells were cultured in adipogenic medium for 14 days.
The purity of MSCs was verified using fluorescent-activated cell sorting (FACS). The absence of the hematopoietic marker CD34 and the lymphocyte common antigen CD45, the presence of mesenchymal markers (CD90, CD73b, CD44, and CD29), and the cell’s ability to differentiate into chondroblasts, osteoblasts, and adipoblasts confirmed that the obtained cells were in fact MSCs.
The clonogenic potential of hASCs from each group was tested by colony forming unit-fibroblastic (CFU-F) assay. The cells were seeded at density
The proliferation factor of hASCs was evaluated using a resazurin assay kit (TOX8, Sigma-Aldrich), following the manufacturers protocol. Test was performed on the 2nd, 5th, and 7th days of the experiment. Based on absorbance, the proliferation factor and PDT were calculated according to a previously described method [
Growth pattern and cell morphology analysis was performed on the 7th day using an inverted, fluorescence microscope (AxioObserverA1, Zeiss) and a scanning electron microscope (SEM; EVO LS15, Zeiss). Evaluation of hASCs morphology included analysis of mitochondria, nuclei, and Golgi apparatus localization, as well as determination of cytoskeleton development. The mitochondria were stained using a rhodamine-based dye, MitoRed (Sigma-Aldrich, Germany), whereas the nuclei were stained using diamidino-2-phenylindole (DAPI). The cytoskeleton was dyed using atto-488-labeled phalloidin. Nuclei and cytoskeleton staining was performed after cells were fixed with 4% paraformaldehyde. Procedures involving fluorescence staining were performed in accordance with manufacturers’ instructions and methods described previously.
After chondrogenic differentiation, cells were stained with 0.1% aqueous solution of Safranin O (specific for proteoglycans). Additionally, after osteogenic and adipogenic differentiation, the presence of calcium deposits and intracellular lipid vesicles was confirmed with Alizarin Red and Oil Red O staining, respectively.
Photographs were acquired using a PowerShot Camera (Cannon).
For SEM imaging, cells were prepared as was described earlier [
The total concentration of chondrogenesis specific markers, Collagen type I (Col-I), Collagen type II (Col-II), Aggrecan (ACAN), and Bone Morphogenetic Protein-2 (BMP-2), was measured by enzyme-linked immunosorbent assay (ELISA) in collected supernatants derived from hASCs cultured in chondrogenic differentiation medium. In order to evaluate adipogenic differentiation efficiency, the concentration of adiponectin (ADIQ) and leptin (LEP) in the adipogenic differentiation medium was measured after 14 days of culture. Bone Morphogenetic Protein-2, ACAN, and Col-I ELISA kits were purchased from R&D Systems (R&D Systems, Abingdon, UK), and Col-II, ADIQ, and LEP kits were purchased from EIAab (Wuhan EIAab Science Co., China). The concentration of proteins was presented as a ratio of protein weight and supernatant volume (w/v).
Expression of cartilage-specific markers (
The primer sequences used in the study are shown in Table
Primer sequences used in qPCR.
Gene | Primer 5′-3′ | Amplicon length (bp) | Accession number |
---|---|---|---|
ACAN | F: GCCTACGAAGCAGGCTATGA | 136 | NM_013227.3 |
R: GCACGCCATAGGTCCTGA | |||
|
|||
ADIQ | F: AGGGTGAGAAAGGAGATCC | 4155 | XM_011513324.1 |
R: GGCATGTTGGGGATAGTAA | |||
|
|||
BMP-2 | F: ATGGATTCGTGGTGGAAGTG | 349 | KC294426.1 |
R: GTGGAGTTCAGATGATCAGC | |||
|
|||
COL-I | F: GTGATGCTGGTCCTGTTGGT | 123 | NM_000088.3 |
R: CACCATCGTGAGCCTTCTCT | |||
|
|||
COL-II | F: GACAATCTGGCTCCCAAC | 257 | NM_001844.4 |
R: ACAGTCTTGCCCCACTTAC | |||
|
|||
GAPDH | F: GTCAGTGGTGGACCTGACCT | 286 | NM_0017008.4 |
R: CACCACCCTGTTGCTGTAGC | |||
|
|||
LEP | F: ATGACACCAAAACCCTCATCAA | 22 | XM_005250340.3 |
R: GAAGTCCAAACCGGTGACTTT | |||
|
|||
OCL | F: ATGAGAGCCCTCACACTCCTC | 292 | NM_199173.4 |
R: CGTAGAAGCGCCGATAGGC | |||
|
|||
OPN | F: AAACGCCGACCAAGGTACAG | 213 | U20758.1 |
R: ATGCCTAGGAGGCAAAAGCAA | |||
|
|||
PPAR |
F: ATGACACCAAAACCCTCATCAA | 125 | AB565476.1 |
R: GAGCGGGTGAAGACTCATGTCTGTC |
Prior to assessing the level of oxidative stress, cells were cultured in normal DMEM growth medium without phenol red. Superoxide dismutase (SOD) activity was measured with the commercially available SOD Assay kit (Sigma-Aldrich, Germany), whereas the level of nitric oxide (NO) was estimated using Griess reagent kit (Life Technologies, USA). The production of ROS was determined by measuring H2DCF-DA (Life Technologies, USA). All procedures were performed in duplicate, according to the manufacturer’s instructions.
As an indicator of senescence in cells,
Group data is presented as mean ± standard deviation (SD). Data analysis was performed using GraphPad Prism 5.0 (San Diego, USA). Statistical significance was determined using one-way analysis of variance (ANOVA) with Tukey’s post hoc multiple comparison test. A
Human ASCs isolated from all four age groups fulfilled the MSC criteria: (i) typical plastic adherent growth; (ii) expression of CD44, CD73, CD90, and CD105 and absence of surface antigens CD34 and CD45 (Figures
Characterization of MSCs. (a) Flow cytometry analysis of MSC positive (CD44, CD73b, CD90, and CD105) and negative (CD34 and CD45) surface markers. (b) Flow cytometry analysis determined the percentage of specific markers in total analyzed hASCs from patients differing in age. Quantification of markers revealed no significant differences between groups. (c) Alizarin Red staining of calcium deposits, Safranin O staining for proteoglycans, and accumulation of lipid droplets dyed with Oil Red O following differentiation into osteoblast, chondroblasts, and adipocyte lineages.
Plastic adherent colonies were observed in all donor samples. All cells displayed proper fibroblasts-like morphology, with predisposition to growth in close contact. Fluorescent staining after 7 days of culture indicated that all cells had the ability to grow in multilayer form, with centrally positioned nuclei. However, cells from donors >70 years were flatter than cells from other groups, with visible giant cells and signs of apoptosis (Figures
Comparison of hASCs morphology from different age groups, evaluated after seven days of propagation. Scale bars: (a–d) 250
Observations of cell growth kinetics revealed that the proliferation rate of cells obtained from young donors (>20 years of age) was significantly higher than in older patients, and the rate increased gradually until cells finally reached full confluence (day 5) (Figure
Comparison of cell proliferation in different age groups. (a) Cell proliferation assay, (b) population doubling time, and (c) fibroblast colony-forming unit efficiency over seven days. Results expressed as mean ± SD.
To validate that the decrease in cell growth results from age-dependent apoptosis, we calculated the number of dead cells (Figure
Characterization of age-dependent apoptosis. (a) Cells stained for senescence showing cells with
Moreover, after 7 days of culture, we observed that cells underwent replicative senescence. This was manifested by the expression of senescence associated beta-galactosidase, which was measured by dye absorption (Figure
Furthermore, we compared the oxidative stress senescence of cells and apoptosis. The obtained results revealed that the ROS level (Figure
Levels of oxidative stress in hASCs. (a) Reactive oxygen species, (b) nitric oxide, and (c) superoxide dismutase levels. Results expressed as mean ± SD.
The ability of hASCs to differentiate into the chondrogenic cell lineage (samples from all four age groups) was evaluated based on lineage specific metabolite production, which was measured by protein and mRNA levels, as well as through observation using an inverted, fluorescence microscope and SEM.
At the beginning of the experiment, cells cultured in the chondrogenic differentiation medium displayed spindle-shape morphology, without any obvious age-dependent changes in cell shape or size. After 16 days of culture, chondro-e-like ASCs spontaneously formed large aggregates. Characteristic chondro-nodules were observed in all investigated cultures. Cells from the donors >20 years of age formed smaller aggregates, between which a cellular monolayer was created with the presence of fibroblast-like cells (Figure
Characterization of age related changes in hASCs chondrogenic differentiation potential. (a) Morphology of cells cultured in chondrogenic medium visualized by Safranin O staining (A–D) and SEM (E–H). Quantitative ELISA analysis and gene expression of (b) Col-II and (c) ACAN. Results expressed as mean ± SD.
Histological staining of chondrogenic samples with Safranin O, after 16 days of induction, showed that the samples from all investigated donor groups formed nodules. The analysis of chondro-nodules in SEM showed that cells from older donors maintained a more spherical shape and had rare lamellopodia, whereas cells from the >20 years old group, formed loosely structured aggregates combined with several small chondro-nodules (Figure
Results of qRT-PCR revealed significant age-related differences in the expression of genes encoding cartilage matrix: Col-II and ACAN (Figures
Osteogenic differentiation of young and old hASCs was evaluated based on extracellular matrix calcification. Mineral calcium deposits and hydroxyapatite-like structures were visualized by Alizarin Red staining and observed in all investigated groups. Noticeably greater nodules were observed in ASCs from younger donors. This coincided with the results of calcium and phosphorus content in bone nodules, measured by SEM-EDX (Figure
Characterization of age related changes in hASCs osteogenic differentiation potential. (a) Morphology of cells cultured in osteogenic medium visualized by (A–D) Alizarin Red staining and SEM (E–H). (b) SEM quantitative evalutaion of ALP secretion.
Gene expression and ELISA anaylsis of osteogenic markers. (a) Gene expression analysis and (b) quantitative ELISA analysis of
Qualitative assessment of Oil Red O staining revealed that, after 14 days, adipogenic induced hASCs populations produced similar amounts of lipid droplets in all investigated groups (Figure
Characterization of age related changes in hASCs adipogenic differentiation potential. (a) Morphology of cells cultured in adipogenic medium visualized by Oil Red O staining (A–D) and SEM (E–H). Quantitative ELISA analysis and gene expression of
The deterioration of the regenerative potential upon aging has been suspected to be due to functional changes in adult stem cells. To confirm this hypothesis, we investigated several distinct parameters including growth curve, proliferation factor, PDT, and differentiation capacity into chondrogenic, osteogenic, and adipogenic lineage in hASCs derived from different donor age groups.
In this study, differences among hASC populations derived from >20, >50, >60, and >70 years old donor groups were manifested by cell expansion properties. Our results found that age significantly affected the growth kinetic and the PDT of the investigated groups, with evident differences between young and elderly patients. Interestingly, there were no significant changes in regard to proliferation activity between the older patient groups. This observation could suggest that while proliferative activity of cells decreases with age, hASCs do not completely lose their proliferative potential, even in the elderly. However, in clinical practice, due to the lower proliferative rates of cells isolated from older patients, it may be necessary to culture and expand MSCs in vitro for a longer period before clinical use, which may lengthen the time needed for clinical autologous application in these patients.
Our data is consistent with results of other studies that were conducted on bone marrow derived MSCs, which showed that aging slowed the PDT [
A reduction in proliferation rate and viability of cells might be ultimately reflected in cell senescence and apoptosis [
Multilineage differentiation potential has been considered an important quality of MSCs [
In this study, age-related osteogenic differentiation capacity was consistent with chondrogenic differentiation potential. We observed an age-related downregulation of cells osteogenic potential. We also detected that cells derived from young donors had an increased expression of osteogenic markers (BMP-2, OPN, and OCL) and were able to form osteonodules with a higher content of calcium deposits. Our findings related to MSCs osteogenic potential are supported by other studies. Choudhery et al. [
Due to the fact that degenerative bone and joint diseases increase in prevalence with age, the age-related decrease in both chondrogenic and osteogenic differentiation potential may be a limitation for the therapeutic applications of hASCs. Future studies should assess ways to overcome the limitations in age-related differentiation capacity. Furthermore, Matsumoto et al. [
In regard to age related adipogenic differentiation, there were conflicting observations. On the one hand, we did not observe differences between age groups in the quantity of lipid droplets accumulation, but on the other hand we have found that leptin, adiponectin, and PPAR-
Understanding the influence of age on MSCs properties is important due to their potential therapeutic use in musculoskeletal disorders that are widespread among the elderly. Our results demonstrate that not only the proliferation status of MSCs, but also their multilineage differentiation capacity, may provide an argument to restrict MSC-based therapies to certain individuals. Future studies comparing the effects of aging on different MSCs populations could help to optimize treatments by identifying an MSC source that is less adversely affected by age.
The authors declare that there is no conflict of interests regarding the publication of this paper.
Publication was supported by Wrocław Centre of Biotechnology, programme the Leading National Research Centre (KNOW) for years 2014-2018. Krzysztof A. Tomaszewski was supported by the Foundation for Polish Science (FNP).