This study aimed to culture and characterize mesenchymal stem cells derived from meniscal debris. Cells in meniscal debris from patients with meniscal injury were isolated by enzymatic digestion, cultured in vitro to the third passage, and analyzed by light microscopy to observe morphology and growth. Third-passage cultures were also analyzed for immunophenotype and ability to differentiate into osteogenic, adipogenic, and chondrogenic lineages. After 4-5 days in culture, cells showed a long fusiform shape and adhered to the plastic walls. After 10–12 days, cell clusters and colonies were observed. Third-passage cells showed uniform morphology and good proliferation. They expressed CD44, CD90, and CD105 but were negative for CD34 and CD45. Cultures induced to differentiate via osteogenesis became positive for Alizarin Red staining as well as alkaline phosphatase activity. Cultures induced to undergo adipogenesis were positive for Oil Red O staining. Cultures induced to undergo chondrogenesis were positive for staining with Toluidine Blue, Alcian Blue, and type II collagen immunohistochemistry, indicating cartilage-specific matrix. These results indicate that the cells we cultured from meniscal debris are mesenchymal stem cells capable of differentiating along three lineages. These stem cells may be valuable source for meniscal regeneration.
The meniscus plays an important role, biochemically and biomechanically, in maintaining homeostasis of the knee [
An alternative to transplantation is meniscal regeneration through cell-based tissue engineering [
Adult MSCs from mesoderm may prove even more effective for meniscal regeneration because they self-renew and show multilineage differentiation potential, immunomodulatory effects, and homing ability [
MSCs are found in nearly all tissues of the body, not just in bone marrow [
To explore whether meniscal debris is a good source of seed cells for meniscal regeneration, we used enzymatic digestion to isolate cells in meniscal debris from patients with meniscal injury, and then we identified these cells as MSCs based on their adherent ability, morphology, phenotype, and multilineage differentiation potential. Such cells may provide adequate amounts of seed cells for meniscal regeneration.
This study was approved by the local Research Ethics Committee, and written informed consent was obtained from all patients. Meniscal debris was collected from 6 patients with meniscal tears (3 men and 3 women; 6 knees, comprising 4 left and 2 right), who underwent arthroscopic partial meniscectomy or plasty. They were diagnosed on the basis of clinical manifestations, magnetic resonance imaging, and arthroscopy. Their median age was 37 years (25–49). The causes of meniscus tears were related to either sport activities (5 patients) or degeneration (1 patient). There were 5 lateral and 1 medial menisci. The median time of surgery after injury was 22 months (2–60). The tears included horizontal (2 menisci), longitudinal (2 menisci, including 1 bucket-handle tear), flap (1 meniscus), and complex (1 meniscus horizontal + longitudinal tears) tears. The tear areas were located either in the anterior horn (2 menisci) or in the meniscal body (4 menisci). The tears involved the white zone (4) or red-white (2) zone. Two patients had concomitant cartilage lesions.
Meniscal debris-derived MSCs were isolated and cultured as previously described [
Potential markers expressed on the surface of third-passage MSCs derived from meniscal debris were analyzed by flow cytometry. Cells were harvested with trypsin/EDTA, then were incubated for 1 h with FITC-conjugated antibodies against CD44 (Abcam), or purified primary antibodies against CD90, CD105, CD34, or CD45 (Abcam). Next, cells were labeled for 30 min with FITC-conjugated secondary antibody. In parallel, cells were incubated with nonspecific mouse IgG instead of primary antibody to detect nonspecific staining. Then cells were fixed in flow buffer, washed, and subjected to flow cytometry and results were analyzed using Cell Quest software (BD Biosciences). The results were expressed as percentages of positive cells on histogram plots relative to the proportions obtained with the isotype-matched negative control.
The potential of third-passage MSCs from meniscal debris to differentiate along three lineages was examined, as previously described [
MSCs were grown to 80–90% confluence and then induced for 2 weeks in osteogenic medium supplemented with 0.1
MSCs were induced for 2 weeks in adipogenic medium consisting of 1
MSCs (106 cells) were collected in 15-mL polypropylene centrifuge tubes, centrifuged at 480 ×g for 10 min, and cultured in micromass for 3 weeks at 37°C with 5% CO2 in high-glucose DMEM supplemented with 100x ITS, 1 mmol/L pyruvate, 0.17 mmol/L ascorbate, 0.1
After inducing MSCs cultures to follow one of the three lineages described above, they were assayed for expression of specific markers for extracellular matrix and transcription factors using real-time quantitative PCR. Total RNA from samples was extracted using RNAVzol reagent (Vigrous) according to the manufacturer’s instructions. Concentration of each RNA sample was measured by UV spectrophotometry and integrity of RNA samples was assessed by agarose gel electrophoresis. Total RNA (2
Primer sequences for quantitative real-time PCR.
Target gene | Primer sequence (5′-3′) | |
---|---|---|
Forward | Reverse | |
Runx2 | TGGTTACTGTCATGGCGGGTA | TCTCAGATCGTTGAACCTTGCTA |
ALP | ACCACCACGAGAGTGAACCA | CGTTGTCTGAGTACCAGTCCC |
OCN | GGCGCTACCTGTATCAATGG | GTGGTCAGCCAACTCGTCA |
Collagen I | GAGGGCCAAGACGAAGACATC | CAGATCACGTCATCGCACAAC |
PPAR | GATGCCAGCGACTTTGACTC | ACCCACGTCATCTTCAGGGA |
Adiponectin | GGTGCTGAAGCCTACCAAC | AGGAAGAACAGACGGCAGAAC |
LPL | TCATTCCCGGAGTAGCAGAGT | GGCCACAAGTTTTGGCACC |
PAS | AAGGACCTGTCTAGGTTTGATGC | TGGCTTCATAGGTGACTTCCA |
aP2 | ACTGGGCCAGGAATTTGACG | CTCGTGGAAGTGACGCCTT |
SOX9 | AGCGAACGCACATCAAGAC | CTGTAGGCGATCTGTTGGGG |
Collagen II | TGGACGCCATGAAGGTTTTCT | TGGGAGCCAGATTGTCATCTC |
GAG | ACTCTGGGTTTTCGTGACTCT | ACACTCAGCGAGTTGTCATGG |
GAPDH | ACACTCAGCGAGTTGTCATGG | ACACCATGTATTCCGGGTCAAT |
Expression levels of each mRNA were reported as mean ± SD (
Nucleated cells were isolated from the meniscal debris using collagenase. After primary cultures had been in the incubator for 2-3 d, the isolated round cells gradually spread out and adhered to the culture dish. By 4-5 d, cells exhibited typical spindle-shaped, fibroblast-like morphology. As time went on, the cells grew more rapidly and took on a swirling or cluster appearance. By 10–12 d, cultures reached 80–90% confluence, whereupon they were subcultured 1 : 2 or 1 : 3. Following the first subculturing, approximately 4-5 days were needed for each passage. Cell morphology remained homogeneous until P3 (Figure
Magnetic resonance imaging (a) showing a typical bucket-handle tear of medial meniscus in sagittal view and arthroscopic examination (b) of patients with meniscal tears. Meniscal debris (c) was obtained during surgery. At 3
Flow cytometry indicated that nearly all third-passage MSCs derived from meniscal debris were positive for the surface markers CD44 (
Phenotypic characteristics of MSCs derived from meniscal debris, based on flow cytometry. Cells were labeled with antibodies against CD44, CD90, CD105, CD34, and CD45. The black lines correspond to fluorescence intensity of anti-marker antibodies, while grey areas correspond to nonspecific anti-mouse IgG as an isotype control (a). Data are presented as mean ± SD (b).
Third-passage MSC cultures were subjected to in vitro differentiation assays in order to investigate their mesenchymal multipotency potential. When cultures were induced to undergo osteogenesis, the cells began to gather and become sparse, changing from a spindle-shaped morphology to a more polygonal one. After 1-2 weeks, the nodules became larger and scattered uniformly. After 14 d, cultures were stained with Alizarin Red (Figure
Osteogenic differentiation potential of third-passage MSCs cultures derived from meniscal debris. After 14-day induction in osteogenic medium, osteogenesis was determined based on deposition of matrix calcification detected by Alizarin Red (a) and based on ALP-specific staining (b). Scale bar
When third-passage cultures were induced to undergo adipogenesis, the volumes of cells and nuclei increased, and intracellular lipid droplets became visible in the cytoplasm by microscopy (Figure
Adipogenic differentiation potential of third-passage MSCs cultures derived from meniscal debris. After 14-day induction in adipogenic medium, adipogenesis was detected as the formation of neutral lipid vacuoles (a) stainable with Oil Red O (b). Scale bar = 200
When third-passage cultures were induced to undergo chondrogenesis, pellets changed to spheroids (Figure
Chondrogenic differentiation potential of third-passage MSCs cultures derived from meniscal debris. At 21 day after chondrogenic induction, chondrogenesis was induced under serum-free micromass pellet culture conditions (a) and analyzed using hematoxylin and eosin staining (b) for general histology, Toluidine Blue (c) and Alcian Blue staining (d) for GAG, and immunohistochemical staining for type II collagen in chondrogenic matrix ((e): low-magnification; (f): high-magnification). Scale bar = 100
In this study, we successfully isolated adherent cells from meniscal tear debris; the cells had a morphology typical of fibroblasts and they expressed a characteristic mesenchymal phenotype, with no expression of hematopoietic surface markers. It was possible to effectively induce the cultured cells to differentiate into osteogenic, adipogenic, or chondrogenic lineages. The cells were identified as MSCs based on their morphology, surface marker expression, ability to adhere to culture surfaces, and multilineage differentiation potential. Our findings suggest that meniscal debris may be a useful source of seeding cells for meniscal regeneration.
Some studies showed that cells in the vascular periphery of meniscal injury, or even in the avascular area, could spontaneously heal the tissue damage [
Whatever the origin of the MSCs in our meniscal debris samples, their properties are similar to those previously reported for human meniscus stem/progenitor cells, which displayed characteristics of MSCs and expressed high levels of Col-II [
We have isolated cells from human meniscal debris that were fibroblast-like and that were able to adhere to plastic and undergo several passages in vitro. The cells showed a distribution of surface markers similar to that previously reported for MSCs. They were also efficiently induced to differentiate into osteoblasts that produced mineralized matrix, adipocytes that accumulated lipid vacuoles, and chondrocytes that produced GAG and Col-II. Real-time PCR analysis confirmed that each differentiated lineage upregulated the corresponding genes for osteogenesis, adipogenesis, or chondrogenesis. Our study demonstrated the existence of MSCs in meniscal debris and showed that they can be cultured and differentiated, opening the door to studies examining their potential for meniscal regeneration.
The authors declare that there is no conflict of interests regarding the publication of this paper.
Weili Fu and Xing Xie equally contributed to this work.
This study was supported by the National Natural Science Foundation of China (81301560), China Postdoctoral Science Foundation (2012M521698), the Fundamental Research Funds for the Central Universities (2015SCU04A40), International Visiting Program for Excellent Young Scholars of Sichuan University, Research Project for Sichuan Provincial Health and Family Planning Commission (150153), and 1.3.5 Project for Disciplines of Excellence of West China Hospital Sichuan University.