Adipose-derived stem cells (ADSCs) are ideal seed cells for use in bone tissue engineering and they have many advantages over other stem cells. In this study, two kinds of calcium phosphate/collagen composite scaffolds were prepared and their effects on the proliferation and osteogenic differentiation of ADSCs were investigated. The hydroxyapatite/
Bone loss due to trauma, inflammation, and surgical processes has posed great difficulty in the aesthetic reconstruction of a functional alveolar bone [
As an important element in alveolar bone tissue engineering, osteogenic cells, in addition to growth factors and scaffolds, have been studied extensively to regenerate new bones and to repair large bone defects. Embryonic, osteoblastic, and adult stem cells have been adopted for such applications [
The materials used for the preparation of bone grafts must be biocompatible, osteoinductive, and osteoconductive. Additionally, the structure and mechanical properties of these materials should be similar to those of natural bones [
While extensive research has been conducted on the effects of HA and TCP on BMSCs [
However, because of the brittleness of such inorganic materials, better effects could be achieved by additionally using organic constituents of natural bone, such as collagen [
In this study, we prepared pure HA particles (HAP) using the traditional solution precipitation method and HA/
CaO (analytical reagent, AR), H3PO4 (AR), H2O2 (AR), NaOH (AR), and absolute alcohol (AR) were all purchased from Beijing Chemical Works (Beijing, China); type-I purity collagen was purchased from Collagen Biotechnology Co. Ltd. (Hebei, China); KBr (spectroscopically pure) was purchased from Botianshengda Co. Ltd. (Tianjin, China); phosphate buffer solution (PBS), Dulbecco’s Modified Eagle Medium (DMEM), and fetal bovine serum (FBS) were all purchased form Thermo Fisher Scientific (USA); MTT and DMSO were purchased from Sigma (USA); Trizol reagent was purchased from Invitrogen (USA); SYBR Green I and the PrimeScript
HAP was synthesized using a reaction of Ca(OH)2 and H3PO4 in water, based on the method described by Antebi et al. [
HTP was prepared by calcining bovine cancellous bone [
The composite scaffolds were prepared using the freeze-drying approach [
The surface morphologies of HAPS and HTPS were examined by SEM using a Hitachi S-4800 SEM (Hitachi, Japan) with 15 kV accelerating voltage. Before the examination, both samples were heated at 40°C for 2 h to remove residual moisture and then underwent spray-gold.
In order to study the microstructures of the two samples, their N2 adsorption isotherms were measured using an AUTOSORB-1 adsorption analyzer (Quantachrome, USA) at −196°C. The specimens were then dried at 200°C for 24 h in a N2 atmosphere to remove the water on the solid surface. The specimens were then exposed to a temperature of 25°C in vacuum to attain a residual pressure of 10−4 Pa. The multipoint BET method was used to measure the specific surface area (
An Energy Dispersive X-ray (EDX) spectrometer (Hitachi S-4800) connected to the SEM was used to determine the elemental combination of the composite material. The specimens did not undergo spray-gold before examination.
FTIR analysis using Shimadzu FTIR-8400S was conducted for the chemical analysis of HAPS and HTPS. The spectral range was set as 4000 to 400 cm−1 with a resolution of 4 cm−1 and scan time of 100. The samples were diluted to a concentration of 1% by mixing with KBr (infrared grade).
X-ray diffraction spectroscopy (XRD) was conducted to examine the crystal phase composition of the samples. A 0.5 mm × 0.5 mm area of each sample was randomly selected and the XRD spectra were acquired at room temperature using an X-ray diffractor (D/max-II; RIGAKU, Japan) with Cu K
To evaluate the strength of HAPS and HTPS, Young’s moduli of all the specimens were determined using a Universal Testing Machine (Instron 300DX, US). Additionally, the Bio-Oss Collagen Young’s moduli were also calculated as a positive control. The dimensions of each specimen were measured using a vernier caliper. These scaffolds were then placed on plates and compressed uniformly. They were then subjected to a force at the rate of 1 mm/min exerted on the top of the scaffolds. The load was augmented until the scaffolds crushed. Force and displacement data were recorded in order to generate the stress-strain curves. By measuring the slope of the stress-strain curve in the elastic region, Young’s modulus could be calculated. Each group had five samples and the results were displayed in the form of mean ± standard deviation.
The water absorption rates of HAPS and HTPS were also determined. Before the water was soaked, the specimens were weighed using an analytical balance (
ADSCs (Poietics Human Adipose-Derived Stem Cells) were purchased from ScienCell (ScienCell, USA) and cultured in 100 mm dishes with Dulbecco’s Modified Eagle Medium (DMEM, GIBCO, USA) supplemented with 10% (v/v) fetal bovine serum (FBS, GIBCO, USA). The medium was replaced every other day and cells were expanded until passage 3. The cells were then digested using a trypsin-EDTA solution (Sigma, USA) and cell number was calculated using a blood counting chamber. The cell suspension was then centrifuged for 5 min at 1200 rpm at room temperature and resuspended in DMEM (10% FBS) to adjust the cell number to 1 × 107/mL. After placing the scaffolds in a 24-well tissue culture plate (CORNING, USA), each well was seeded with 200
After culturing for 1, 3, 5, and 7 days, cell proliferation was determined using the MTT method. In brief, each well was aspirated and washed with PBS three times. Next, 700
Total RNA was extracted from the ADSCs after 3 and 5 days of culture on HAPS and HTPS using Trizol reagent (Invitrogen, USA) by following the manufacturer’s protocol. SYBR Green I (TaKaRa, Japan) was used for quantitative real-time polymerase chain reaction and the PrimeScript RT reagent Kit was used for reverse transcription. The target PCR primers for ALP, BMP-2, OCN, OPN, COL1A1, COL2A, and ACTIN were designed using the Basic Local Alignment Search Tool® (Table
Primer sequences for RT-qPCR.
Primer number | Primer sequence (5′-3′) | Target gene | Product size (bp) |
---|---|---|---|
osgD145 | CGACAGCAAGCCCAAGAG | ALP | 110 |
osgD146 | GTGGAGACGCCCATACCA | ||
|
|||
osgD155 | ACATCCGCTCCACAAACG | BMP-2 | 132 |
osgD156 | GGTGCCACGATCCAGTCA | ||
|
|||
osgD149 | CTTCTCAGAGCCTCAGTCC | OCN | 129 |
osgD150 | ACCGTAGATGCGTTTGTAG | ||
|
|||
ACTINF | ACTCGCTGCGCTCGGTCGTT | ACTIN | 125 |
ACTINR | CCTTTTGCTGGCCTTTTGCTCAC | ||
|
|||
osgD286 | CACTCCAATCGTCCCTAC | OPN | 127 |
osgD287 | GTCCTCATCTGTGGCATC | ||
|
|||
osgD316 | CCCTGGACAGCCTGGACTT | COL1A1 | 95 |
osgD317 | CATAGGACATCTGGGAAGCAA | ||
|
|||
osgD290 | ACCTTGGACGCCATGAAA | COL2A | 102 |
osgD291 | CTTGCTGCTCCACCAGTTT |
In order to observe the morphology of the cells after seeding them on the scaffolds, the immunofluorescence staining of the cytoskeleton of the ADSCs was conducted. After 24 h of incubation on both scaffolds, the cells were gently washed with 0.01 M PBS three times and then fixed in 4% glutaraldehyde PBS solution for 20 min at room temperature. The cells were then again washed with PBS three times, and 0.5% Triton X-100 PBS solution was applied on the cells for 5 min to increase cell membrane permeability. After washing again with PBS, the cells were incubated with FITC phalloidin (Alexis, USA) for 20 min in the dark at room temperature. The cells were then washed with PBS three more times and then incubated in DAPI (5
The data are represented as the mean ± SD. In terms of statistical comparison, this study adopted the
The pictures and SEM images of HAPS and HTPS are shown in Figure
Pictures and SEM images of HTPS and HAPS. (a) HTPS group; (b) HAPS group; (c) SEM images of the HTPS group, 500x; and (d) SEM images of the HAPS group, 500x.
The EDX spectra were obtained for HAPS and HATS to determine the element composition. The EDX results (Table
Results of EDX analysis for HTPS and HAPS.
Element | At% | At% |
---|---|---|
HTPS | HAPS | |
CK | 39.64 | 48.49 |
NK | 05.40 | 06.12 |
OK | 34.17 | 28.74 |
NaK | 00.69 | 00.56 |
MgK | 00.44 | 00.30 |
PK | 07.47 | 05.62 |
ClK | 00.15 | 00.93 |
CaK | 12.04 | 09.28 |
In the HAPS, the molar ratio of Ca/P accords with HA (1.67). In the HTPS, the molar ratio was less than 1.67. After calculation, the HA/
The FTIR spectra (Figure
FTIR patterns of HTPS and HAPS. Both the groups share the same organic and inorganic composition. Note: green line: HTPS; purple line: HAPS. Dashed lines indicate similar symbolic peaks of the two groups: 1030 cm−1:
The XRD spectra (Figure
XRD spectra of HTPS and HAPS. Note: green line: HTPS; purple line: HAPS. Note: round symbols indicate the symbolic peaks of hydroxyapatite and triangles at 23.4°–23.7° and 26.9°–27.4° demonstrate the symbolic peaks of
Figure
Young’s moduli of HTPS and HAPS.
The
Porosity analysis of HTPS and HAPS.
The water absorption rate of HTPA and HAPS is shown in Figure
Water absorption rate of HTPS and HAPS.
Cell proliferation on the scaffolds can reflect the toxicity and biocompatibility of the scaffold materials. MTT assays were, therefore, conducted to determine the proliferation of ADSCs on both HAPS and HATS. The growth curves (Figure
MTT line graph of HTPS and HAPS.
Osteogenesis-related gene expression could reflect the differentiation of ADSCs into osteoblasts, the key seed cells in bone tissue engineering. After the culture of ADSCs for 3 and 5 days, the mRNA levels of ALP, BMP-2, OCN, OPN, COL1A1, COL2A, and ACTIN were examined using RT-qPCR, and the results are shown in Figure
Gene expression of ALP, BMP-2, OCN, OPN, COL1A1, and COL2A in ADSCs cultured on HAPS and HTPS for 3 and 5 days. Note:
The cytoskeleton is a dynamic system of many cellular functions and could be an excellent indicator of the behavior of the ADSCs (Figure
Fluorescence images of the ADSC seeded on HAPS and HTPS. Note: (a and b): ADSCs on HAPS at 24 h, 10x and 20x objective lenses, respectively, and (c and d): ADSCs on HTPS at 24 h, 10x and 20x objective lenses, respectively.
Bioscaffolds have played an important role as one of three main elements of tissue engineering [
Compared with HA prepared by chemical synthesis, inorganic bovine bone has better bone formation ability because its components and microstructure are similar to that of the natural bone [
Excellent mechanical property not only provides a mechanical support for bone formation, but also makes the materials conducive for use in clinical applications. Both HAPS and HTPS have Young’s moduli similar to that of Bio-Oss Collagen, which has been widely used in clinical practice [
Stem cell-based therapy has become a promising tool in some fields such as craniofacial bone regeneration and spine surgery, and a randomized controlled clinical trial has shown positive effects of such therapy [
In this study, two composite collagen scaffolds, HAPS and HTPS, were prepared using mineral particles distributed homogeneously in type-I collagen grids. HTPS contained 50%
The authors declare that they have no competing interests.
Qing Li and Tong Wang equally contributed to this paper.
This research was financially supported by the National High Technology Research and Development Program of China (863 Program, no. 2014AA022109), Beijing Science Foundation (Z151100003715006), National Basic Research Program of China (973 Program, 2011CB710901), National Key Technology R&D Program (nos. 2014BAI11B15, 2012BAI18B06, and 2012BAI18B05), and the 111 Project of China (no. B13003).