Adipose tissue contains abundant multipotent mesenchymal stem cells with strong proliferative and differentiating potential into adipocytes, osteocytes, and chondrocytes. However, adipose-derived mesenchymal stem cells (ASCs) showed variable characteristics based on the tissue-harvesting site. This study aimed at comparing human adipose-derived mesenchymal stem cell from the orbit (Orbital ASCs) and abdomen (Abdominal ASCs). Orbital and abdominal ASCs were isolated during an upper or lower blepharoplasty operation and liposuction, respectively. Flow cytometric analysis was done to analyze the surface antigens of ASCs, and cytokine profiles were measured using Luminex assay kit. The multilineage potential of both ASCs was investigated using Oil Red O, alizarin red, and alcian staining. Reverse transcriptase polymerase chain reaction (RT-PCR) was performed to measure mRNA levels of genes involved in these trilineage differentiations. Our results showed that both types of ASCs expressed the cell surface markers which are commonly expressed stem cells; however, orbital-ASCs showed higher expressions of CD73, CD90, CD105, and CD146 than abdominal ASCs. Unlikely, orbital-ASC expressed CD31, CD45 and HLA-DR lesser than abdominal-ASCs. Orbital ASCs secreted higher concentrations of eotaxin, fractalkine, IP-10, GRO, MCP-1, IL-6, IL-8, and RANTES but lower MIP-1
Mesenchymal stem cells (MSCs) are widely applied in regenerative medicine for the treatment of tissue damage due to some pathological diseases or trauma [
Adipose tissue can be isolated easily by various methods like blepharoplasty, levator muscle resection, and laparotomy in abundant quantity from many sites, such as the abdomen, breast, buttock, orbit, and thigh [
The aim of this study is to characterize and compare human ASCs isolated form the orbit and abdominal tissues and also to compare their capacity during multilineage differentiation.
The study participants were 10 healthy men aged between 35 and 55 years and included both types of tissues, orbital and abdominal from the same individual. Tissues were isolated within clinical studies approved by the institutional review board.
Orbital ASCs and abdominal ASCs were isolated following the protocol described in the previous study with minor modifications [
Cells at passage 3 (p3) were detached by using trypsin-EDTA 0.2% (Gibco, Carlsbad, CA, USA), fixed with methanol for 10 min at −20°C, washed with 1% BSA in PBS, and then incubated with permeabilization buffer: 0.1% Triton X-100 and 1% BSA in PBS for 10 min at 4°C. Cells were incubated with antibodies raised against CD31, CD34 CD45, CD73, CD90, CD105, CD146, and HLA-DR (Santa Cruz Biotechnology, Dallas, TX, USA) on ice for 30 min. Cells were pelleted, washed, and fixed in 1% paraformaldehyde. Fluorescence-activated cell sorting (FACS) analysis was performed on BD Biosciences FacsCalibur flow cytometer (Becton Dickinson, San Jose, CA, USA) using FlowJo software for analysis.
We quantified various cytokines and growth factor concentrations secreted from both types of ASCs by using Luminex multiplex assay kit (Millipore, Billerica, MA, USA) according to the manufacturer’s instructions. This assay kit measured protein concentrations of chemokines: eotaxin, fractalkine, interferon-gamma inducible protein-10 (IP-10), monocyte inflammatory protein (MCP)-1, macrophage inhibitory protein (MIP)-1
Orbital and abdominal ASCs were cultured with adipogenic medium that contains 30
Orbital and abdominal ASCs with confluent growth were cultured in a serum-free Stem Pro osteogenesis differentiation kit (Life Technologies). Cells were cultured with complete growth medium (control) or induced medium for 21 days, and the medium was changed every 2-3 days. Cells were stained with alizarin red S stain (Sigma-Aldrich; St. Louis, MO, USA), and mineralization during osteogenesis was measured quantitatively following the manufacturer’s instructions. In brief, cells were incubated with 10% acetic acid for 30 min at RT, scraped and transferred to new tubes (1.5 ml), followed by heating at 85°C for 10 min, and then cooled in ice. After removal of debris by centrifugation, the supernatant was transferred to a new tube, normalized with 10% ammonium hydroxide solution, and absorbance was measured at 405 nm [
Orbital and abdominal ASCs with 80% confluency were cultured in chondrogenic differentiation kit (Life Technologies), and the medium was changed every 2-3 days. After 3 weeks, cells were stained with alcian blue stain (Sigma) according to the manufacturer’s protocol. For quantitative measurement, stained cells were extracted with 6 M guanidine HCl for 2 h at RT and absorbance was measured at 650 nm [
Total RNA was extracted from orbital and abdominal ASCs using TRIzol RNA isolation reagent, according to the manufacturer’s instructions. RNA was quantified with NanoDrop 1000 (Thermo Fisher, Waltham, MA, USA). We used 1
Lists of human primer sequences used for reverse transcription polymerase chain reaction (RT-PCR).
Primers | Forward sequences | Reverse sequences |
---|---|---|
ATTGACCCAGAAAGCGATTC | ATTGACCCAGAAAGCGATTC | |
GGGTCTGAGACTCCCTTTCCTT | CTCATTGGTCCCCCAGGAT | |
AACCTTAGATGGGGGTGTCCTG | TCGTGGAAGTGACGCCTTTC | |
TTTGGACACCAGGTTGGTGAA | ACGAATCCATGGTTGGCGT | |
GCACAAACATGGCCAGATTC | AGA AATCTACGAGCAAGGTC | |
TCCTGCCGATGTCGCTATC | CAAGTTCCGGTGTGACTCGTG | |
CCTCCCCTTCACGTGTAAAA | GCTCCGCTTCTGTAGTCTGC | |
TACCCGCACTTGCACAAC | TCTCGCTCTCGTTCAGAAGTC | |
TGAGAAACGGCTACCACATC | ACTACGAGCTTTTTAACTGC |
Results are expressed as means ± SEM and analyzed using GraphPad Prism software (version 5.0, GraphPad Software, San Diego, California). The two-tailed unpaired Student
Flow cytometric analysis resulted that orbital ASCs expressed CD31, CD45, and HLA-DR expressions by 93.64, 94.19, and 94.40% lower than abdominal ASCs, respectively. However, both types of ASCs expressed significantly low percentage of CD34 expression which is one of the characteristic features of stem cells. The typical markers of stem cells, such as CD90, CD73, CD105, and CD146, were significantly higher in both types of ASCs; however, orbital ASCs showed these expressions higher than abdominal ASCs by 3.93, 20.73, 13.61, and 18.35%, respectively (Figure
Phenotypical characterization of orbital and abdominal ASCs. (a) Flow cytometric analysis of surface markers of ASCs. (b) Luminex assay to measure secreted cytokines by both types of ASCs. Results are presented as means ± standard error mean (SEM).
Quantitative chemokine assay showed that orbital ASCs showed higher concentrations of chemokines, such as eotaxin, fractalkine, IP-10, MCP-1, and RANTES, respectively, by 30.6, 66.2, 57.8, and 83.3% but lower concentrations of MIP-1
Orbital and abdominal ASCs were induced with adipogenic medium for 21 days to examine the lipid droplets during adipogenesis and compared with noninduced cells or control (cells grown on complete growth media). Oil Red O staining results showed orange color for lipid droplets which was higher in orbital ASCs when compared with abdominal ASCs (Figures
Adipogenic differentiation of orbital and abdominal ASCs towards adipogenesis. (a) Microscopic photograph of ASCs cultured in adipogenic medium for 21 days and subjected to lipid staining with Oil Red O. Control cells were grown in DMEM/F12 medium for the same period of time. (b) Quantitation analysis of lipid droplet accumulation by determining the amount of dye extracted with isopropanol and measured at absorbance 540 nm. (c) Real-time PCR analysis for genes involved in adipogenesis, such as
Orbital and abdominal ASCs were subjected to osteogenic medium for 21 days in culture. Our result showed that both types of ASCs showed positive staining with alizarin red stain in osteogenic medium (induced) when compared to complete growth medium (control) (Figure
Osteogenic differentiation of orbital and abdominal ASCs towards osteogenesis. (a) Microscopic photograph of ASCs cultured in osteogenic medium for 21 days and stained with alizarin red stain. Control cells were grown in DMEM/F12 medium for the same period of time. (b) Quantitation analysis of mineralization by determining the amount of dye extracted and measured at absorbance 405 nm wavelength. (c) Real-time PCR analysis for genes involved in osteogenesis, such as
After 21 days of chondrogenic induction, ASCs were stained with alcian blue stain and compared with noninduced cells. ASCs induced with chondrogenic medium showed aggregation of cells and increased extracellular matrix production which was stained positively by blue color in alcian blue staining as shown in (Figures
Chondrogenic differentiation of orbital and abdominal ASCs towards chondrogenesis. (a) Microscopic photograph of ASCs cultured in chondrogenic medium for 21 days and stained with alcian blue. Control cells were grown in DMEM/F12 medium for the same period of time. (b) Quantitation analysis of extracellular matrix production by determining the amount of dye extracted with 6 M guanidine HCl and measured at absorbance 620 nm wavelength. (c) Real-time PCR analysis for genes involved in chondrogenesis, such as
This study aimed at comparing the characteristic alteration and differentiation capacity between adipose-derived mesenchymal stem cells (ASCs) and orbital and abdominal tissues. Though orbital and abdominal ASCs were not detached naturally but could be harvested by collagenase digestion then expanded
ASCs derived from any site are supposed to express mesenchymal stem cell (MSC) markers but not consistently express all the characteristics of MSC, and the profile expression changes with culture time [
Most chemokines, such as RANTES, MCP-1, and IP-10, attract the inflammatory cells, dendritic cells, monocytes, macrophages, and T lymphocytes, while IL-6 secretion is associated with pluripotency and immune privilege of MSCs [
Adipogenic differentiation is regulated by a complex network of transcription factors that begins with increased expressions of CCAT/enhancer-binding protein (C/EBP)
Previous studies reported that
The present study has some limitations that should be noted. Firstly, we did not determine the mRNA expressions during the early stage of differentiation of ASCs, and secondly, protein levels of signaling mechanisms involved in trilineage differentiations were not investigated. To the best of our knowledge, this is the first comparative study of ASCs derived from orbital and abdominal fat tissues with their trilineage capabilities of differentiation. Collectively, although isolated from similar adipose tissues, both types of ASCs displayed many contrasting characteristics in terms of surface markers and cytokine release. In addition, orbital ASCs have more capabilities towards adipogenesis and osteogenesis, but less tendency to chondrogenic differentiation when compared to abdominal ASCs. Further studies on the mechanism of trilineage differentiation need to be elucidated. Understanding defining phenotypes of such cells is useful for making suitable choices in different regenerative clinical indications like cell-based therapy and tissue engineering.
The human adipose tissues were supplied by Bundang CHA Medical Center and approved by the institutional review board. Sequences of primers used in our study are available with accession number and can be provided upon request. All data are provided in full in Results of our manuscript, and the necessary detail can be provided by the corresponding author under request.
The authors declare there is no conflict of interest regarding the publication of this paper.
This research was supported by grants from the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health and Welfare, Republic of Korea (Grant no. HI16C1559).