Extremely low-frequency pulsed electromagnetic field (ELF-PEMF) devices have been used in the clinic for the treatment of bone disorders over the past 30 years. However, the underlying mechanism of which ELF-PEMFs exert an effect on tissues at a cellular level is not well understood. Hence, in this study, we explored the potential of different ELF-PEMF signals in modulating human adipose-derived mesenchymal stromal cells’ (hAMSC) osteogenic capability. The cell proliferation rate was assessed using carboxyfluorescein succinimidyl ester (CFSE) method. The osteogenesis potential of cells was determined by alkaline phosphatase (ALP) activity, Alizarin-Red S staining, and RT-qPCR. Finally, the intracellular signaling pathway of a selected ELF-PEMF signal was examined using the PathScan Intracellular Signaling Array. Among the tested ELF-PEMF signals, program 20 (26 Hz) showed activation of the Akt and MAPK/ERK signaling cascade and significant upregulations of collagen I, alkaline phosphatase, and osteocalcin when compared to nonstimulated cells. This study demonstrates the potential of certain ELF-PEMF signal parameters to induce osteogenic differentiation of hAMSC and provides important clues in terms of the molecular mechanisms for the stimulation of osteogenic effects by ELF-PEMF on hAMSC.
Clinical intervention of large bone defects is limited. Autografts (transplantation of patient’s own tissue) remain the gold standard for treating large bone defects. Despite exhibiting high healing rates, autografts have associated disadvantages; approximately 20–30% of autograft patients experienced donor site morbidity and are complicated by fracture, nonunion, and infection. Therefore, effective treatments for such bone defects are urgently needed.
Over the years, cell therapy has been proven to be a viable strategy that can aid the process of bone regeneration [
ELF-PEMF therapies aimed at aiding fracture repair have been investigated clinically for more than 30 years. Many efforts have been geared towards understanding the fundamental mechanism of ELF-PEMF stimulation on MSC harvested from different sources (i.e., alveolar bone-derived MSC [
Within this context, we performed this study in an attempt to identify further potential ELF-PEMF signals that can potentially guide or enhance the osteogenic capabilities of hAMSC. Subsequently, the intracellular signaling pathways activated in hAMSC due to exposure of ELF-PEMF were examined.
Isolation of hAMSC from 6 donors (
To evaluate the proliferative and osteogenic differentiation behavior of hAMSC when exposed to different ELF-PEMF signals, cell culture plates/flasks were placed onto the applicator (Figure
Peak magnetic field magnitude distribution across the cell culture plate (6 mm above the applicator). Yellow line outlined the contour of the applicator.
ELF-PEMF signals utilized in the study. Frequencies (pulse repetition rate) of the ELF-PEMF signals investigated.
“CIT program number” | Pulse repetition rates (Hz) |
---|---|
4 | 10.0 |
16 | 16.0 |
10 | 20.6 |
18 | 23.8 |
20 | 26.0 |
64 | 33.0 |
31 | 49.9 |
81 | 52.3 |
114 | 75.6 |
124 | 90.6 |
Figure
The cell culture studies were divided into two sequential parts. In the first part (study 1), hAMSCs were trypsinised and plated with a density of 1 × 104 cells/cm2 in 1 96-well plate. The osteogenic differentiation of hAMSC was induced using DMEM-low glucose supplemented with 100 U/ml penicillin, 100
In the second part (study 2), hAMSCs were identically plated at a density of 1 × 104 cells/cm2 and cultured in osteogenic medium. The cells were exposed to one ELF-PEMF signal identified in study 1 also for 7 mins (single exposure). After a defined resting period (of 30 mins, 1, 2, 3, 4, and 6 hrs), samples were collected for intracellular cell signaling arrays. In both studies, hAMSCs cultured in osteogenic medium without ELF-PEMF exposure were used as control.
Cell proliferation was assessed using CFSE (Abcam®, ab113853, UK). Briefly, cells were fluorescence labelled with 1
At days 3, 7, and 14, cells were fixed with ice-cold methanol for 15 mins and incubated in SRB solution for 30 mins. Subsequently, cells were washed with 1% acetic acid solution to remove unbound SRB. Then, SRB was incubated with 10 mM unbuffered Tris solution for 15 mins to dissolve bound SRB. Finally, absorbance was measured at 565/690 nm using a plate reader (BMG Labtech, Germany). A standard curve with known protein amount was generated and used for the calculation of corresponding value for all samples.
On days 3, 7, and 14, cell culture medium was aspirated, and cells were washed once with PBS. Then, cells were covered with ALP substrate solution (i.e., 3.5 mM 4-disodium-4-nitrophenyl phosphate prepared in 0.1 M AP-buffer consisting of 50 mM glycine, 100 mM Tris-base, and 2 mM magnesium chloride at pH 10.5) for 30 min at 37°C. Subsequently, 100
At different time points (3, 7, and 14 days), the culture was washed twice with PBS and fixed with ice-cold methanol for 15 mins. Subsequently, culture was stained with 3% (
This procedure was performed for semiquantification of the extent of matrix mineralization. Briefly, on days 3, 7, and 14, cells were washed with PBS and fixed with ice-cold ethanol for 30 mins at room temperature. Then, cells were washed with distilled water (dH2O) and incubated with 0.5% (
On days 3, 7, and 14, the cells were harvested, and mRNA was extracted using Tri Reagent (Sigma-Aldrich, Germany) according to manufacturer’s recommendations. RNA quantification and quality control were done with NanoDrop (Nanodrop Tech, USA). Reverse transcription to cDNA was performed in a C1000 Touch Thermal Cycler (Eppendorf, Germany) using a first strand cDNA synthesis kit (Thermo Scientific, USA) and following the instructions of the manufacturer. qPCR was performed in a CFX96 Real-Time System thermocycler using SsoFast EvaGreen supermix (Bio-Rad, Hercules, CA, USA) as a detection reagent for the gene expression of RunX2, osteocalcin, osteopontin, osterix, ALP, and collagen type I (COLIAI). Primer sequences used are listed in Table
Forward and reverse primer sequences and annealing temperature for the respective genes.
Gene | Forward primer | Reverse primer | Annealing temperature (°C) |
---|---|---|---|
RunX2 | TGCCTAGGCGCATTTCAGGTGC | TGAGGTGATGGCGGGGTGT | 60 |
Osteocalcin | CCAGCGGTGCAGAGTCCAGC | GACACCCTAGACCGGGCCGT | 60 |
Osteopontin | CTCCATTGACTCGAACGACTC | CGTCTGTAGCATCAGGGTACTG | 60 |
Alkaline phosphatase | ACGTGGCTAAGAATGTCATC | CTGGTAGGCGATGTCCTTA | 57.5 |
Collagen I | AGCGGACGCTAACCCCCTCC | CAGACGGGACAGCACTCGCC | 60 |
Βeta-tubulin | GAGGGCGAGGACGAGGCTTA | TCTAACAGAGGCAAAACTGAGCACC | 60 |
The intracellular cell signaling pathway was examined using the PathScan Intracellular Signaling Array Kit (Cell Signaling Technology, The Netherlands) following the manufacturer’s protocol. Briefly, cells were lysed using ice-cold lysis buffer and the lysates were diluted to 1 mg protein per ml solution using array diluent buffer. Following that, 75
Cell proliferation, protein content, ALP activity, and Alizarin Red S data were represented as mean ± standard error of mean (SEM). Cell signaling protein array data was represented as mean ± standard deviation (SD). The cell proliferation, protein content, ALP activity, and Alizarin Red S data were subjected to two-way analysis of variance (two-way ANOVA) and Tukey’s post hoc test (GraphPad Prism 7.0). Significance level was set at
Cell proliferation was assessed by CFSE and SRB (protein content). CFSE is a membrane-permeant fluorescent dye that covalently attaches to free amines of cytoplasmic proteins, and the CFSE fluorescence within daughter cells progressively halved following each cell division [
Graphs show fold change of (a) cell proliferation and (b) protein content to the respective day 3 of the group (left graphs) and to the control group (without ELF-PEMF exposure) of the same culture period (e.g., 3 versus 3 days, 7 versus 7 days, and 14 versus 14 days) (right graphs). Mean ± SEM,
All cells were cultured under osteogenic media to determine if the application of ELF-PEMF would enhance the differentiation of hAMSC towards osteogenic lineage. ALP activity slightly increased for control, ELF-PEMF groups 4, 31, and 114 at day 7 compared to the respective day 3 of the group (Figure
Graph shows fold change of (a) alkaline phosphatase (ALP) and (b) Alizarin Red S content to the respective day 3 cultured group and to the control (without ELF-PEMF exposure) of the same culture period (e.g., 3 versus 3 days, 7 versus 7 days, and 14 versus 14 days). Mean ± SEM,
Generally, Alizarin Red S and von Kossa assays (Figures
Representative images of culture stained with von Kossa on days 3, 7, and 14 immediately after exposure with ELF-PEMF. Control: cells without ELF-PEMF exposure. Scale bar = 500
Of the ten different ELF-PEMF signals, seven (e.g., CIT numbers 10, 16, 18, 20, 64, 114, and 124) were further investigated in terms of osteogenic gene expression (Figure
Graph showing the relative gene expression of (a, d) COLIAI, (b, e) alkaline phosphatase (ALP), (c, f) RunX2, (g, i) osteopontin, and (h, j) osteocalcin after (a–c, g, h) 3 and (d–f, i, j) 7 days in culture under the various ELF-PEMF signals. Data were plotted as fold change to control of the same culture period, represented by the dotted line (
Cells treated with CIT numbers 20 and 124 showed significant upregulation of COLIAI after 3 days of exposure compared to control. Moreover, CIT number 20 also resulted in a significant upregulation of ALP and osteocalcin for the same time of observation. On the other hand, CIT number 18-treated cells showed significant upregulation of RunX2 expression after 7 days compared to control. Osteopontin expression levels were slightly, but not significantly, elevated for all ELF-PEMF groups except for CIT number 114 on both days 3 and 7 compared to control.
Based on the observations from part 1 of the study, it was indicated that 26 Hz ELF-PEMF (CIT number 20) shows potential of triggering osteogenesis of hAMSC (upregulation of COL1A1, ALP, and osteocalcin genes at day 3) as compared to other ELF-PEMF signals. Thus, this signal was selected for the elucidation of intracellular cell signaling pathways using a protein array. The system used allowed for the detection of 18 different proteins involved in proliferation, growth, apoptosis, and/or stress signaling when phosphorylated or cleaved. Figure
Graph shows the levels of key phosphorylated/cleaved proteins involved in the Akt, MAPK/ERK, and caspase signaling pathways in hAMSC subjected to 26 Hz ELF-PEMF (CIT number 20) exposure in osteogenic media. Protein quantification was examined immediately, 0.5, 1, 2, 3, 4, or 6 hours after the completion of the ELF-PEMF exposure. Data were plotted as fold change to control (hAMSC culture in osteogenic media without ELF-PEMF exposure), represented by the line (
Generally, it was observed that the amount of phosphorylated Akt, AMPK
Across all tested ELF-PEMF programs, none caused irreversible cytotoxicity to hAMSC as evidenced by the increasing cell proliferation and protein production over time. This observation was in line with that of intracellular signaling array. When exposed to 26 Hz ELF-PEMF (CIT number 20), a stress-related pathway was activated. This is evidenced by the increase in HSP27 activation, which has been shown to protect cells from undergoing apoptosis under stress conditions [
In this study, ELF-PEMFs were applied to hAMSC cultured in osteogenic-conditioned media to elucidate the potential of ELF-PEMF in acceleration of hAMSC osteogenesis differentiation. All groups (including control) show a general increase of mineralized matrix over time. However, only prominent differences in terms of extent of mineralization were observed on day 3 in ELF-PEMF-treated groups compared to control. This indicated that ELF-PEMFs do elicit a positive response towards hAMSC matrix mineralization. However, in our experiments, we noted a dramatic difference in terms of the capability to form mineralized matrix among the different donor hAMSC as reflected in the relatively large deviation (Figure
At the gene level, it was observed that hAMSC exposed to 26 Hz ELF-PEMF (CIT number 20) exhibited a more prominent differentiation into osteogenic lineage compared to other exposure groups as evidenced by the increase in ALP (an early marker for osteoblast progenitors), COLIAI (collagen type I, the most abundant ECM protein in bone tissue), and osteocalcin (secreted by mature osteoblasts and commonly used to represent terminal osteoblast differentiation) gene expression after 3 days of exposure. The temporal expression of osteogenic-related genes can be utilized to characterize osteoblasts’ maturation process [
Based on the gene expression profiles, a protein array was chosen to further elucidate the underlying intercellular signaling pathways that lead to enhanced hAMSC potential for osteogenic differentiation. Akt signaling cascade was activated in hAMSC when exposed to 26 Hz ELF-PEMF (CIT number 20), marked by the increased levels of phosphorylated Akt at Ser473 and Thr308, p70 S6 kinase, and S6 ribosomal protein [
Our results also suggest coactivation of ERK 1/2 signaling pathway in hAMSC exposed to 26 Hz ELF-PEMF, as shown by the increased levels of phosphorylated ERK1/2 shortly after exposure. Studies have reported that the Akt [
Illustration of the intracellular signaling pathways investigated on human adipose-derived mesenchymal stromal cells when subjected to ELF-PEMF. The coactivation of ERK and Akt in response to CIT program number 20 exposure promoted cell growth and survival and prevented apoptosis despite of certain levels of cellular stress.
Recently, using the same ELF-PEMF device, Ehnert et al. [
The quantitative data from, that is, ALP, RT-qPCR, and intracellular signaling pathway array used to support the findings of this study are available from the corresponding author upon reasonable request. The ELF-PEMF signal pattern data used to support the findings of this study were supplied by Sachtleben GmbH, Hamburg, Germany, and so cannot be made freely available. Requests for access to these data should be made to Karsten Falldorf at
Karsten Falldorf is an employee of Sachtleben GmbH. All other authors declare that they have no conflicts of interest.
This study was funded by Sachtleben GmbH. This work was supported by the German Research Foundation (DFG) and the Technical University of Munich (TUM) in the framework of the Open Access Publishing Program.