The plant hormone, ethylene, is an important regulator which involved in regulating fruit ripening and flower senescence. In this study, RNA interference (RNAi) technology was employed to silence the genes involved in ethylene biosynthetic pathway. This was achieved by blocking the expression of specific gene encoding the ACC oxidase. Initially, cDNA corresponding to
Fruit constitutes an important part of daily diet, thus contributing to its demand in local and worldwide markets. Due to its ever-growing market, the maintenance of certain fruit traits, including nutritional value, flavor, processing qualities, and shelf-life is desirable [
The inhibition of fruit ripening is achieved by reducing ethylene production [
Scientific advancement in gene silencing has rendered more effective and reliable methods for the use of RNA interference (RNAi). The RNAi concept lies in its sequence-specific RNA degradation principle, where the most efficient method to silence an endogenous gene in plants is through a hairpin RNA (hpRNA). This RNA consists of an inverted repeat of a gene sequence fragment and is separated by an intron to increase the frequency of silencing [
Until today, many RNAi studies on
Total RNA was isolated from wounded leaves. The method used for RNA extraction was the method of Lopez-Gomez (1992) with slight modification [
For RNAi construction, the cloning method was based on site-specific recombination. A 368 bp fragment was amplified from pGEMT vector using gene-specific primers which linked to the att-B sequence (attB1-ACO-F 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTCGTGTCCGAAGCCTGATCT3′, attB2-ACO-R 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTCCAGCAATTCTGGTGCTG3′). The attB-PCR product was purified, and BP recombination reaction with this product was performed with pDONR to produce an entry clone according to manufacturer’s protocol [
Schematic diagram of the binary vector constructed for transformation of
The recombinant plasmid was transferred into
For the confirmation of putative transformants, genomic DNA was isolated from leaves of putative transgenic and wildtype plants using the CTAB method [
DNA (20
Tomato (Solanum
Ethylene production from ripe fruit was measured by enclosing four-to-six pieces of fruit in containers (355 mL) and allowing ethylene and carbon dioxide (CO2) to accumulate for 2 h. Gas samples were collected from the headspace to determine ethylene and CO2 concentrations. Samples were analyzed for ethylene using a Perkin Elmer gas-chromatograph (Clarus 500, USA), flame ionization detector, and a stainless steel column packed with alumina. The carrier gases consist of pure nitrogen. For CO2 measurements, the gas chromatograph equipped with a thermal conductivity detector and helium gas as the carrier gas. The temperature of the injector, detector and oven was 100, 220, and 50°C, respectively.
Tomato skin color was evaluated using reflectance meter (Minolta Chromameter, Japan) and recorded as numerical values of
Fruit firmness was determined by measuring the amount of force (
To start enzymes extraction and assay, tomato fruits (10 g) were homogenized in 10 mL of 0.1 M citrate buffer (pH 4.6) containing 1 M NaCl, 13 mM EDTA, 10 mM 2-mercaptoethanol and 2% (w/v) polyvinylpyrrolidone (PVP-40). The homogenate was then centrifuged (Sorvall RC-5B Superspeed) at 29,000 g for 20 minutes at 4°C. Supernatants were recovered by filtering through a double layer of nylon cloth, and the volume was determined for the enzyme assay. Polygalacturonase (PG), pectin methylesterase (PME), and
The experiments were conducted using a completely randomized design (CRD) with four replicates. Analysis of variance (ANOVA) was carried out using the MSTAT-C software [
Screening of transgenic tomatoes was done using genomic DNA isolated from kanamycin resistant lines as templates. Positive bands with an expected size of 552 bp were observed in 29 out of 120 putative transgenic lines produced. Figure
(a) Detection of transgenes in regenerated tomato plants by PCR. Lane
To confirm the integration of the transgene, Southern blots were performed on genomic DNA digested with
RNA expression patterns through tomato fruit ripening as determined by Northern blot. Wells 1–5 are tomatoes at ripening stages: 0, 25, 50, 75, and 100%. Total RNA extracted from (a) wildtype, (b) RNAi transgenic fruits. RNA expression patterns in (c) wildtype, (d) RNAi fruits, and (e) actin gene as an internal control.
In all transgenic lines, there were no significant differences in the time taken for fruit to develop from anthesis to breaker stage. Fruits were harvested at the mature green stage. Transgenic tomatoes showed prolonged shelf life of more than 32 days, while it took 10 days to reach full ripeness in wildtype tomatoes. Ethylene production varied between transgenic lines (data not shown). The best lines, T11 and T23, which showed more than 75% reduction in ethylene production, were selected for further analysis.
Ethylene production and respiration rates of tomato transgenic fruits were affected by
(a) Ethylene production and (b) respiration rate in tomato fruits during ripening.Each value is the mean ± SE of 4 containers.
The rate of CO2 production during ripening of wildtype fruit reached a peak at day six after harvest (124.2 ± 4.8 nL/g/hr) and then declined, while in RNAi fruits, respiratory peak was delayed to day 32, and the highest level (112.4 ± 3.1 nL/gr/hr) was significantly less than that observed in control fruit (Figure
Ethylene is known to play an utmost important role in regulating fruits ripening and its development especially in climacteric fruits by coordinately inducing the expression of large numbers of genes which finally contribute to ripening [
The results also show a strong correlation between ethylene evolution from fruits and
Besides ethylene, the rate of CO2 production, during ripening of both wildtype and transgenic fruits, exhibited a typical climacteric pattern of respiration. Rate of respiration is often a good index for the storage life of fresh fruits and vegetables; that is, the higher the rate, the shorter the life, and the lower the rate, the longer the life. Accordingly, in this study, tomato spoiled in a shorter period under conditions in which the fruit respired more rapidly. This fact was especially apparent in the case of wildtype tomato fruits (Figure
It is evident from the data that
Fruits | Days | ||||||||
---|---|---|---|---|---|---|---|---|---|
|
|||||||||
0 | 4 | 8 | 12 | 16 | 20 | 24 | 28 | 32 | |
Wild-type | −17.02 | 13.49 | 30.59 | 38.63 | nd | nd | nd | nd | nd |
pq | h | c | a | ||||||
RNAi | −17.16 | −16.29 | −13.31 | −5.19 | 11.32 | 21.59 | 27.91 | 30.97 | 37.42 |
qr | p | mn | k | hi | de | cd | bc | ab |
Means with the same letters in a column are not significantly different at
nd: not detected due to rotting.
As the storage continued, the green color began to fade, more in the wildtype fruits as seen by their faster increases in
In this study, development of the skin color was delayed in transgenic fruits, and these results suggest that the activity of enzymes involved in these processes is somehow associated with ethylene. The retardation of color development in transgenic tomato fruit could be attributed to the low ethylene production and delayed increment in ethylene production to reach the threshold concentration for indication of color development.
Figure
Changes in (a) weight loss, (b) soluble solids concentration, (c) titratable acidity, and (d) ascorbic acid of transgenic and wildtype tomato fruits during ripening. Each value is the mean of four replicates. The vertical bars represent the standard errors.
The mature green fruit of wildtype plants had soluble solid content (SSC) of 4.29%. These values reached 6.52% toward the end of storage (Figure
The soluble solids include organic acids, reducing sugars, and other constituents of the fruit sap affecting the % SSC. Sugars and organic acids develop during the ripening process and tend to increase with the import of sugar from the plant and from mobilization of the starch reserves in the fruit itself [
Results obtained from our study show that TA decreased with the storage time in both wildtype and transgenic fruit. The initial total acid contents at day zero were in the range of 0.37% for the control to 0.38% for RNAi fruit (Figure
In general, organic acid levels can be used as an indicator for postharvest quality. Acid levels decline during ripening, presumably due to its consumption during respiration. The titratable acidity decreases throughout the fruit development until full maturity. In tomato, citric acid is a major organic acid, and its level decreases during ripening [
The level of ascorbic acid was also measured (Figure
In present research, the slower increase in ascorbic acid in transgenic fruits suggests that the
Firmness decreased with increased storage period at a slower rate in RNAi fruit. In the beginning of storage, all the fruits were very firm (firmness from 35.89 N to 36.81 N), but for wildtype fruit, a large reduction in firmness occurred between day 2 and day 8; however, RNAi fruits lost their firmness slowly to 13.66 N at the end of the storage period (Figure
Changes in firmness (a), polygalacturonase (b), pectin methylesterase (c), and
The softening was greatly reduced with
Due to the economic importance of fruit softening, we measured three important hydrolyses that are implicated in tomato cell wall degradation. The activity of polygalacturonase was found to be very low in unripe tomato fruits (Figure
During ripening, softening of fruit is caused by the conversion of protopectin into soluble polyuronides [
The work presented here has successfully demonstrated that by using RNAi technology, several transgenic lines of lowland tomato cultivar MT1, harboring an hpRNA-ACO1 construct, showed lower ethylene production because the transgenic fruits displayed delayed postharvest life with no phenotypic changes and similar amounts of SSC, TA and ascorbic acid as compared to wildtype fruits. Thus, hpRNAi ACO1 could effectively be used to delay postharvest damage, especially in climacteric fruits.
This research is founded by grants 02-01-02-SF0145 from Ministry of Science Innovation and Technology and UKM-OUP-KPB-33-169/2010 from National University of Malaysia, awarded to Z. Zainal. The authors would like to extend their thanks to CSIRO for their generous gift of pHelsgate8 vector. They thank members of Horticulture Research Center of MARDI for the assistant in postharvest analysis. B. Behboodian was partly supported by a scholarship from Universiti Kebangsaan Malaysia.