Porcine torovirus (PToV) was detected from intestinal samples of piglets with diarrhea from 20 farms in southwest China. The total prevalence of PToV was 45% (9 out of 20 farms); it was the first detection of PToV in China, and also the study analyzed the phylogenetic relationships between the Chinese PToV and PToV reference strains as well as other representative toroviruses. Genetic and phylogenetic analysis showed the existence of genetic diversity among geographically separated PToV. Statistical analysis of the PToV positive rate as well as a survey for other enteric pathogens in diarrheic pigs suggests that PToV may play a role as a causative agent of severe diarrhea in piglets.
168 samples of feces or intestines from piglets that died of severe diarrhea from 20 farms in southwest China were collected during the winter of 2011, when there were epidemic outbreaks of diarrhea that occurred with high morbidity and mortality, which has caused great economic losses. Of note, most of the sampled piglets were one to three weeks old, and antibiotic treatment was invalid in all sampled piglets.
For viruses detection, intestinal mucosa was grinded with liquid nitrogen and then mixed with intestinal contents. The mixture was diluted in 2 × volume (wt/vol) of phosphate-buffered saline (PBS, pH 7.4) and finally clarified by low-speed centrifugation at 3,000 ×g for 10 min. The supernatants were subsequently collected and subjected to RNA extraction. Total RNA of supernatants were extracted using TaKaRa RNAiso Reagent and dissolved in DEPC treated water, respectively. The strand cDNA was synthesized by reverse transcriptase (RT) using TaKaRa reverse transcription system. A primer pair targeting the spike (S) protein gene was used for the detection of PToV. The PCR was performed at 94°C for 5 min, followed by 30 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for 30 s, followed by a final extension at 72°C for 7 min. All specimens were also tested for the presence of PEDV (porcine epidemic diarrhea coronavirus), PRV A–C (porcine group A–C rotaviruses), TGEV (transmissible gastroenteritis coronavirus), AV (astroviruses), MRV (mammalian orthoreovirus), calicivirus (PSaV (porcine sapovirus), and PNoV (porcine norovirus) in accordance with the methods in previous studies [
RT-PCR and nested PCR primers used in this study.
Target virusesa | Target genesb | Primer sequence, 5′–3′c | Size (bp) | Source or reference |
---|---|---|---|---|
PToV | S | F: ACCCCTGCCTGAGGTTTCYTT |
451 | Established by our own laboratory |
PEDV | S | F: TTCTGAGTCACGAACAGCCA |
651 | Kim et al. (2001) [ |
PKBV | 3D | F: TGGATTACAAGTGTTTTGATGC |
313 | Established by our own laboratory |
|
VP6 | F: AAAGATGCTAGGGACAAAATTG |
308 | |
nF: GACAAAATTGTCGAAGGCACATTATA |
121 | |||
PRV B | NSP2 | F: CTATTCAGTGTGTCGTGAGAGG |
434 | Gouvea et al. (1991) [ |
|
VP6 | F: CTCGATGCTACTACAGAATCAG |
366 | |
nF: CTCGATGCTACTACAGAATCAG |
328 | |||
TGEV | ORF1b | F: GGGTAAGTTGCTCATTAGAAATAATGG |
1006 | |
S | ||||
AV | RdRp | F11: GARTTYGATTGGRCKCGKTAYGA |
422 | Chu et al. (2008) [ |
|
L1 | F: GCATCCATTGTAAATGACGAGTCTG |
416 | |
nF: GCTAGGCCGATATCGGGAATGCAG |
344 | |||
PSaV and PNoV | RdRp | F: GATTACTCCAAGTGGGACTCCAC |
319 | Kim et al. (2010) [ |
To confirm the specificity of the fragments obtained by RT-PCR, PCR products were purified and used for sequencing. The purposed band, about 450 bp, was excised and then purified using Biomed gel extraction kit (BEIJING BILOMED CO., LTD) according to the manufacturer’s instructions. The resulting products were cloned into pMDT-19 simple vector (Takara) for sequencing.
The nucleotide and deduced amino acid sequences of the partial S gene were compared with other known toroviruses on the GenBank. Sequence similarity analysis was performed for the aligned nucleotide (excluding primer pair sequences) and amino acid sequences by the Clustal W method using the Megalign 7.2 program of Lasergene software (DNASTAR, Madison, WI, USA). Phylogenetic trees were carried out based on nucleotide alignments using the MEGA 5 program.
Using the RT-PCR assay (targeting a 451 bp fragment of the S gene of PToV), 9 out of 20 farms were positive for PToV. Among the 9 farms, two farms tested positive for PToV alone, while the remaining 7 farms had mixed infection with other viruses tested; no consistent association between PoTV and these viruses was observed. For other tested enteric pathogens, PEDV, PKBV, and PRV A had high positive rates which were 55% (11 out of 20 farms), 70% (14 out of 20 farms) and 75% (15 out of 20 farms), respectively, while none of the samples were positive for PRV B and calicivirus (PSaV and PNoV). Besides, 40% (8 out of 20 farms) samples were MRV positive, and positive rates of AV and TGEV were both 25% (5 out of 20 farms). Summary of enteric pathogens present in the porcine samples obtained from diarrheic pigs was listed in Table
Summary of enteric pathogens present in piglets with diarrheic obtained from 20 farms.
Farm no. | PToV | PEDV | PKBV | PRV A | PRV B | PRV C | TGEV | AV | MRV | PSaV and PNoV |
---|---|---|---|---|---|---|---|---|---|---|
1 | + | + | − | + | − | − | + | − | − | − |
2 | + | + | + | + | − | − | − | − | − | − |
3 | − | − | + | + | − | + | − | − | + | − |
4 | − | + | + | + | − | − | + | − | − | − |
5 | − | + | − | + | − | − | − | − | + | − |
6 | − | + | + | + | − | − | − | + | + | − |
7 | + | − | − | − | − | − | − | − | − | − |
8 | + | − | + | − | − | − | − | − | − | − |
9 | − | − | − | + | − | + | − | − | − | − |
10 | + | + | + | + | − | − | + | − | − | − |
11 | + | + | + | − | − | − | − | + | + | − |
12 | − | − | + | − | − | − | − | + | + | − |
13 | + | − | + | + | − | − | − | − | + | − |
14 | + | − | + | + | − | − | + | − | − | − |
15 | − | + | + | + | − | − | − | − | + | − |
16 | − | + | + | + | − | − | − | − | + | − |
17 | − | + | − | + | − | − | − | + | − | − |
18 | + | − | − | − | − | − | − | − | − | − |
19 | − | + | + | + | − | − | + | − | − | − |
20 | − | − | + | + | − | − | − | + | − | − |
(+) indicates a positive result in PCR; (−) indicates a negative result in PCR.
The newly determined sequences have been deposited in the NCBI nucleotide sequence database and assigned the following accession numbers: KC340952 (farm numbers 1 and 2); KC340953 (farm number 7); KC340954 (farm numbers 8 and 11); KC340955 (farm number 10); KC340956 (farm number 13); KC340957 (farm number 14); KC340958 (farm number 18).
For 9 farms positive for PToV, the RT-PCR yielded a product of the anticipated size of 451 bp. Sequence analysis confirmed that the product was porcine torovirus specific. Those that shared the same sequence were neglected. Pairwise comparison of nucleotide sequences of the partial S gene confirmed that the strains are more closely related to the porcine torovirus. Comparison of the nucleotide (exclude the primer sequences) and deduced amino acid sequences of the fragment of the S gene of Chinese PToV strains showed that the Chinese PToV strains were highly conserved for the region, which had 90.2%–99.8% nucleotide and 93.7%–99.3 deduced amino acid identity with each other, and they formed a single lineage on the phylogenetic tree (Figure
Phylogenetic analysis of partial PToV-S gene sequences obtained from Chinese farms and torovirus sequences available in GenBank. Gene sequences were aligned using the ClustalW method and the phylogenetic tree was performed by the neighbour joining method using 1000 bootstrap. Sequences from this study were marked red.
In China, PToV-associated diarrhea has not been reported; even there was little information about PToV epidemiology. However, longitudinal, serological, and virological studies on PToV in piglets were carried out in Spanish and Europe and also RT-PCR method and real-time PCR were developed to detect PToV qualitatively or quantitatively in Korea [
PToV has been detected in swine diarrhea samples and also high incidence of PToV infection in diarrhea samples was observed in our study. It was worth noting that two diarrhea samples were tested positive for PToV alone, and a previous study has reported a diarrhea sample tested positive for PToV alone when a survey for enteric pathogens in diarrheic pigs was carried out [
The study is supported by Sichuan Province Science and Technology Support Projects (2012NZ0001) and Education Ministry’s New Century Excellent Talents Supporting Plan (NCET 11-1059).