The paper describes comparative evaluation of IAVchip DNA microarray, reverse transcription PCR (RT-PCR), and real-time RT-PCR versus virus isolation in chicken embryos and shows their diagnostic effectiveness in detection and subtyping of influenza A virus. The tests were evaluated with use of 185 specimens from humans, animals, and birds. IAVchip DNA microarray demonstrates higher diagnostic effectiveness (99.45%) in early influenza A diagnosis as compared to the real-time PCR (98.38%) and RT-PCR (96.22%), thus showing its clear superiority. Diagnostic sensitivity of IAVchip DNA microarray (100%) exceeds the same of RT-PCR (95.95%) and real-time RT-PCR (97.96%) in the range of estimated confidence intervals. IAVchip DNA microarray and real-time RT-PCR displayed equal diagnostic specificity (98.85%), while diagnostic specificity of RT-PCR was 96.40%. IAVchip DNA microarray has an advantage over the other tests for influenza A diagnosis and virus identification as a more rapid method that allows performing simultaneous detection and subtyping of about tens of specimens within one experiment during 8–10 hours. The developed IAVchip DNA microarray is a general test tool that enables identifying simultaneously 16 hemagglutinin (HA) and 9 neuraminidase (NA) subtypes of influenza A virus and also to screen the influenza A viruses from humans, animals, and birds by M and NP genes.
Influenza A virus (IAV) belongs to Orthomyxoviridae family. IAV is subtyped according to antigenic specificity of the surface glycoproteins hemagglutinin (HA) and neuraminidase (NA). Today 16 hemagglutinin and 9 neuraminidase subtypes are known [
Owing to the high mutation rate of the surface HA and NA glycoproteins of IAV subtyping appears to be difficult; therefore, it is necessary to use supplementary methods and tools of diagnosis as well as their combinations to get reliable results [
So far, the DNA microarray-based detection is one of promising techniques in differential diagnosis of IAV infection, since it allows combining efficiency of the nucleic acid amplification and ample capacities of screening with use of biochip [
IAVchip DNA microarray [
Smears and swabs from humans, animals, and birds (185 samples in total) were used as a test subject. Forty-two human samples were taken in Kazakhstanean hospitals under the Program of Epidemiological Surveillance in 2012 from cases suspected for acute respiratory viral infection and were kindly provided to our laboratory by the Republican sanitary-epidemiological station.
Eighty-five samples were collected in 2012 from horses with signs of a respiratory infection in Kostanaiskaya, Almatinskaya, and Zhambylskaya oblasts under the Republican Science-and-Technology Program “Epizootiological monitoring of the territory of Kazakhstan, Central Asian and Neighboring Countries for Equine Influenza”.
Fifty-eight samples from wild birds were taken in 2005-2006 and in 2012 in Akmolinskaya and Karagandinskaya oblasts under the Program of Avian Influenza Surveillance.
Sampling was carried out following WHO recommendations [
One has the following: plasmid DNA containing IAV M gene; plasmid DNA containing IAV NP gene.
M gene (EU213070.2) and NP gene (EU213048.1) were cloned into strain XL1-Blue
RNAs were extracted from samples with the help of TRizol (“Invitrogen,” USA) following the manufacturer’s instructions.
One-step RT-PCR was performed with use of Super Script III Platinum One-Step Quantitative RT-PCR System (“Invitrogen,” USA) following the manufacturer’s instructions. The universal primer pair selected for the terminal highly conservative regions that are present in all IAV genome segments (MBTuni-12 and MBTuni-13) has been used in multisegment amplification [
An experimental batch of microarrays was printed on aldehyde substrate (Vantage Aldehyde Slides “CEL Associates”) by the method of contact printing of oligonucleotide probes in Nano Print LM 60 (“Arrayit,” USA) in accordance with the scheme on Figure
Scheme of the model IAVchip microarray for influenza A virus subtyping. H: hemagglutinin, N: neuraminidase, PC: positive control, BUF: 1xMicroarray printing buffer Arrayit, and NNM: hybridization control.
The scheme includes the probes corresponding to hemagglutinins HA1–HA16 and then to neuraminidases NA1–NA9. In addition there is a universal oligonucleotide probe to the region of IAV genes that encode M and NP proteins shared by all IAV subtypes. Oligonucleotide probes used in the experiments are shown in Table
Oligonucleotide probes for influenza A virus subtyping.
Subtype | Probe | Sequence |
---|---|---|
hemagglutinin | ||
1 | H1-1 | gaagggagaatgaactattactggacactagtagagccgggagacaa |
H1-2 | gtctccctgggggcaatcagyttctggatgtgytcyaatggg | |
H1-3 | acaggactaaggaacatcccatccattcaatccagaggtttgtttgg | |
|
||
2 | H2-1 | taaggaatgttccccagattgaatcaagaggattgtttggggcaat |
H2-2 | gtcaccgtgactcatgccaaggacattcttgagaaaacgcataatgg | |
H2-3 | tatgctacagtagcaggytccctgtcactggcaatcatgata | |
H2-4 | tgggatgtcataaattttgagagcactggtaatttaattgcaccagaata | |
|
||
3 | H3-1 | atgtgggcctgccararaggcaacattaggtgcaacatttgc |
H3-2 | atgtgggcttgccaaaaaggcaacatcagatgcaacatttgc | |
H3-3 | cagcaactgttacccttatgatgtgccggattatgyctccct | |
|
||
4 | H4-1 | gcactrcttttagcctttattttgtgggcttgtcagaatggaaacat |
H4-2 | attttgtgggcttgtcagaayggaaacatccggtgccagatttg | |
H4-3 | ttccatatcatgcttyttgctcgttgcactrcttttagcctt | |
|
||
5 | H5-1 | ttgggacatcaacactaaaccagagattggtaccaaraatagctactaga |
H5-2 | ttattcaacagtggcragttccctagcactggcaatcatggt | |
H5-3 | cccaacaataaagagragytacaataataccaaccaagaagatcttttgg | |
H5-4 | cccaacaataaagaggacctayaacaacaccaatgtagaagaccttttaa | |
H5-5 | tttatagagggaggatggcagggaatggtagatggttggtatgg | |
H5-6 | ctagatgtctggacttataatgctgaacttctggttctcatggaaaatga | |
|
||
6 | H6-1 | cttggtgtgtatcaaattcttgcyatttatagtacggtatcgagcag |
H6-2 | caaatccttgcyatttatagtacggtatcgagcagtctrgttttgg | |
H6-3 | gcaatgggtctttggatgtgttcaaatggttcaatgcartgca | |
|
||
7 | H7-1 | atgggattggttttcatttgcataaagaatggaaacatgcrgtgcactat |
H7-2 | cttcggggcatcatgtttcatacttctggccattgcaatggg | |
H7-3 | catcaaaatgcacaaggagarggaactgcagctgactacaaa | |
H7-4 | tggtttagcttcggggcatcatgcttcctwcttcttgccattgcaatggg | |
|
||
8 | H8 | atttacagtacagtggcggccagtctytgcttggcaatcctg |
|
||
9 | H9-1 | cttacaaaatcctyaccatttattcgactgtcgcctcatctcttgt |
H9-2 | gcaatggggtttgctgccttcytrttctgggccatgtccaat | |
H9-3 | ttctgggccatgtcyaatggatcttgcagatgcaacatttgtat | |
|
||
10 | H10-1 | cttttggctgtcatcatggggcttgttttcttctgtytgaaaaatggaaa |
H10-2 | gtcatcaattggacyaaggattcaataaccgacatctggacttatcarg | |
|
||
11 | H11-1 | gatctccatgattctaatgttcgaaacctccatgaaaaggtcagacgaat |
H11-2 | tgggcgtgcagyaatggatcatgtagatgtaccatttgcatt | |
|
||
12 | H12 | tactgctcatgattattgggggtttcattttcggrtgtcaaaatggaaat |
|
||
13 | H13-1 | agtgttgtgytagtaggactcatactctctttcatcatgtgggcc |
H13-2 | ataaatatgcttgcagacagaatagatgaygctgtaactgatgta | |
|
||
14 | H14 | tgcatcacccatcaagcgataatgagcaaacggatctctacaagg |
|
||
15 | H15 | gctgatctgataatagaaagaagaaattcaagtgacatctgttacccagg |
|
||
16 | H16-1 | taatgccattgatgaaggagatggttgcttcaatcttcttcacaa |
H16-2 | attcgaaatgggacatataatcatgaggactacaaagaagagtcacaa | |
|
||
Neuraminidase | ||
1 | N1-1 | gggttggtcttggccagacggtgctgagttgccattyaccatt |
N1-2 | tcctaatggatggacarataccgacagtgatttctcagtgaaacaggatg | |
N1-3 | tggtcttggccagacggtgctgagttgccvttcaccattgac | |
N1-4 | caagagtctgaatgtgcatgtgtaaatggytcttgctttactgtaatgac | |
|
||
2 | N2-1 | caagtgtgyatagcatggtccagctcaagttgtcacgatggaaa |
N2-2 | tttggsraccaaacaagtgtgcatagcatggtccagctcaag | |
N2-3 | ttttgtggcacttcaggyachtatggaacaggctcatggcct | |
N2-4 | tgtgghacytcaggtacatatggaacaggctcatggcctgat | |
|
||
3 | N3 | agyaatagtatagttactttctgtggaytagacaatgaacctggatcggg |
|
||
4 | N4 | tgtggtgttaattctgataccacaggttggtcatggccygatggc |
|
||
5 | N5 | ttttgtggtgtttcmagtgaggtcccaggrtggtcctgggatgatgg |
|
||
6 | N6-1 | tcatgccatgacggcatctcaagaatgtcratctgcatgtca |
N6-2 | gagcgattrggatcatggtcctggcatgatggtgctgaratc | |
N6-3 | gagcgattgggatcktggtcatggcatgatggggctgaaatc | |
|
||
7 | N7-1 | gttgaaggatgggtagtggtggcyaaggacaatgccataagatt |
N7-2 | cagttgggtccggttccttccccgatggggcacaratccaat | |
|
||
8 | N8-1 | atatggacctcwagyagctccattgtgatgtgtggagtagaycat |
N8-2 | tgagtgtagaaatagggcaatcacccaatgtgtaccaggcaaggt | |
N8-3 | tggtcrtggcacgatggagctattcttccytttgacatcgat | |
|
||
9 | N9 | atgtgttccagyacagaattcctkggacaatggaactggcctgat |
|
||
M2-protein | ||
M2-1 | gcagartgctgtggatgttgacgatrgtcattttgtcaacatag | |
M2-2 | cctatcagaaacgaatgggggtgcagatgcaacgattcaagtga | |
M2-3 | ccttctacggaaggagtrccwgagtctatgagggaagaatatcg | |
|
||
NP protein | ||
NP-1 | acgaaaaggcaacgaacccgatcgtgccttcctttgacatga | |
NP-2 | atgagtaatgaaggdtcttatttcttcggagacaatgcagargag |
One microarray slide allows simultaneous analysis of 16 different IAV strains and isolates.
IAVchip DNA microarray was validated with use of IAV reference strains of different subtypes, origin, and biological characteristics [
To 1
The microarrays were scanned in InnoScan710AL (“Innopsys,” France) with 5
Virus isolation was performed in 9-10-day chicken embryos (CE) following the standard procedures where influenza virus production was confirmed by identification in hemagglutination inhibition (HI) test [
Real-time RT-PCR was performed by method of “TaqMan” with use of Light Cycler 2.0 manufactured by Roche Company. Real-time RT
RT-PCR for detection of Н1N1 and Н3N2 subtypes was performed according to Schweiger et al. (2000) [
Specific regions of IAV cDNA were produced in GeneAmp PCR 9700, Applied Biosystems. Table
Oligonucleotide primers and probes for influenza A virus typing and subtyping in real-time PCR and RT-PCR.
Influenza virus type/subtype | Primer or probes | Sequence |
---|---|---|
A | AM-151 | CATGGAATGGCTAAAGACAAGACC |
AM-397 | AAGTGCACCAGCAGAATAACTGAG | |
Probe AM-245 | CTGCAGCGTAGACGCTTTGTCCAAAATG | |
A/H1N1 | ||
A/H1 | HA1-583 | GGTGTTCATCACCCGTCTAACAT |
HA1-895 | GTGTTTGACACTTCGCGTCACAT | |
Probe HA1-783 | TGCCTCAAATATTATTGTGTCCCCGGGT | |
A/N1 | NA1-1078 | ATGGTAATGGTGTTTGGATAGGAAG |
NA1-1352 | AATGCTGCTCCCACTAGTCCAG | |
Probe NA1-1138 | TGATTTGGGATCCTAATGGATGGACAG | |
A/H3N2 | ||
A/H3 | HA3-115 | GCTACTGAGCTGGTTCAGAGTTC |
HA3-375 | GAAGTCTTCATTGATAAACTCCAG | |
Probe HA3-208 | CTATTGGGAGACCCTCATTGTGATGG | |
A/N2 | NA2-560 | AAGCATGGCTGCATGTTTGTG |
NA2-858 | ACCAGGATATCGAGGATAACAGGA | |
Probe NA2-821 | TGCTGAGCACTTCCTGACAATGGGCT | |
A/H3N8 | ||
A/H3 | EqFlu HA3 F | TCACATGGACAGGTGTCACTCA |
EqFlu HA3 R | GGCTGATCCCCTTTTGCA | |
EqFlu HA3 Pr | AACGGAAGAAGTGGAGC | |
A/N8 | N8Eq-F30 | TGG ATC TGC ATC ATT GGG GA |
N8eq-R535 | CTG ACC ATG CCA CCG ATT CA | |
A/H5N1 | ||
A/H5 | H5HA-205-227v2-F | CGATCTAGAYGGGGTGAARCCTC |
H5HA-326-302v2-R | CCTTCTCCACTATGTANGACCATTC | |
H5-Probe-239-RVa | FAM-AGCCAYCCAGCTACRCTACA-MGB | |
H5-Probe-239-RVb | FAM-AGCCATCCCGCAACACTACA-MGB | |
A/N1 | N1-For-474-502 | TAYAACTCAAGGTTTGAGTCTGTYGCTTG |
N1-Rev-603-631 | ATGTTRTTCCTCCAACTCTTGATRGTGTC | |
N1-Probe-501-525 | FAM-TCAGCRAGTGCYTGCCATGATGGCAMGB |
AM: M gene of influenza A viruses.
HA1, HA3, and HA5: HA gene of influenza A viruses of subtypes H1, H3, and H5, respectively.
NA, NA2, and NA8: NA gene of influenza A viruses of subtypes N1, N2, and N8, respectively.
True positive (TP), true negative (TN), false positive (FP), and false negative (FN) results of the assays were used to assess effectiveness of laboratory tests.
The following calculations were used: sensitivity
95% confidence intervals (95% CI) were calculated according to van Engelsdorp et al. [
Diagnostic effectiveness of IAVchip DNA microarray in comparison to the virus isolation in chicken embryos, real-time RT-PCR, and RT-PCR for IAV detection and subtyping was evaluated by testing 185 clinical specimens from humans, animals, and birds.
“True” state of infection is determined by the most accurate diagnostic method that is called “gold standard.” In diagnostics and identification of the influenza infection virus isolation in chicken embryos followed by identification in HI is the “gold standard” [
Table
Comparison of the results of our test using IAVchip DNA-microarray with the results of real-time RT-PCR and RT-PCR.
Result | Test | |||
---|---|---|---|---|
RT-PCR | Real-time PCR | IAVchip DNA microarray | Virus isolation in chicken embryos | |
Positive | 71 (38.38%) | 96 (51.89%) | 98 (52.97%) | 98 (52.97%) |
False positive | 4 (2.16%) | 1 (0.54%) | 1 (0.54%) | 0 |
False negative | 3 (1.62%) | 2 (1.08%) | 0 | 0 |
Negative | 107 (57.84%) | 86 (46.49%) | 86 (46.49%) | 87 (47.03%) |
|
||||
Total | 185 (100%) | 185 (100%) | 185 (100%) | 185 (100%) |
In our experiments IAV was isolated by the method of virus isolation in chicken embryos from 98 (52.97%) specimens out of 185 clinical samples taken from humans, animals, and birds. The rest of samples (87, i.e., 47.03%) showed negative result. The same picture was observed in the experiments aimed at IAV isolation with use of IAVchip DNA microarray. In these tests the influenza A virus was detected in 98 (52.97%) samples. At the same time the method of real-time PCR displayed the presence of IAV only in 96 (51.89%) specimens, and the method of RT-PCR merely in 71 (38.38%) samples. Percentage of false positive results in the tests with use of IAVchip DNA microarray and in the real-time PCR was 0.54% and 2.16% in RT-PCR. Use of IAVchip DNA microarray did not show false negative responses, while real-time PCR and RT-PCR displayed 1.08% and 1.62%, respectively.
Sensitivity and specificity of each test were determined to evaluate effectiveness and reliability of influenza A diagnostic tests.
Sensitivity and specificity indices, as well as positive and negative prognostic values of the developed IAVchip DNA microarray, of RT-PCR and real-time RT-PCR with 95% confidence interval are displayed in Table
Comparative diagnostic value of different tests in influenza A diagnosis.
Result, % | Test | ||
---|---|---|---|
RT-PCR | Real-time RT-PCR | IAVchip DNA microarray | |
SN, 95% CI | 95.95 (93.15–98.75) | 97.96 (95.96–99.96) | 100 |
SP, 95% CI | 96.40 (93.70–99.10) | 98.85 (97.35–100) | 98.85 (97.35–100) |
PPV, 95% CI | 94.67 (91.37–97.97) | 98.97 (97.57–100) | 98.99 (97.59–100) |
NPV, 95% CI | 97.27 (94.97–99.57) | 97.73 (95.63–99.83) | 100 |
SN: sensitivity; SP: specificity; PPV: Positive Predictive Value; NPV: Negative Predictive Value; 95% CI: 95% confidence interval.
Method of virus isolation in chicken embryos being used as a standard, IAVchip DNA microarray displayed 100% diagnostic sensitivity and 98.85% diagnostic specificity within the range 97.35–100% of 95% CI. Diagnostic sensitivity of IAVchip DNA microarray (100%) exceeds the same parameter of real-time RT-PCR (97.96%) within the range 95.96%–99.96% of 95% CI and of RT-PCR (95.95%) within the range 93.15%–98.75% of 95% CI.
In influenza A diagnosis IAVchip DNA microarray and real-time PCR demonstrated equal diagnostic specificity (98.85%), while the same characteristic of RT-PCR was 96.40%. Diagnostic specificity of IAVchip DNA microarray and real-time PCR were in the range of the confidence intervals of the RT-PCR specificity. The limit of the 95% confidence intervals for RT-PCR was 93.70%–99.10%.
PPV and NPV values of IAVchip DNA microarray were 98.99% and 100%, respectively. PPV and NPV of the real-time RT-PCR were also in the range of the estimated confidence intervals.
IAVchip DNA microarray, real-time RT-PCR, and RT-PCR were used to subtype IAV from 98 samples proved to be positive by the method of the virus isolation in chicken embryos. The IAV were subtyped by the methods of RT-PCR and real-time RT-PCR in 3 steps: identification of the virus (step 1), detection of HA (step 2), and NA (step 3). IAVchip DNA microarray was used to subtype simultaneously the tested IAV with probes specific to hemagglutinin 1–16 and neuraminidase 1–9 genes. Table
Results of influenza A virus subtyping with use of IAVchip DNA microarray.
Subtypes | A | B |
---|---|---|
H1N1 |
|
|
|
||
H3N2 |
|
|
|
||
H3N8 |
|
|
|
||
H5N1 |
|
|
A: hybridization pattern of the assayed influenza virus.
B: results of subtyping after mean value counting of fluorescent spots; H1, H3, and H5: hemagglutinin gene subtypes; N1, N2, and N8: neuraminidase gene subtypes; M, NP: markers of nucleoprotein and matrix protein genes.
As Table
The results of comparative analysis of samples with use of IAVchip DNA microarray, as well as by real-time RT-PCR and RT-PCR, are shown in Table
Results of detecting influenza A virus subtypes in clinical specimens by various tests.
Subtype | Test | ||||||
---|---|---|---|---|---|---|---|
Reverse transcription PCR | Real-time RT-PCR | IAVchip DNA microarray | |||||
Step 1 | Step 2 | Step 3 | Step 1 | Step 2 | Step 3 | Step 1 | |
Type A | H | N | Type A | H | N | Type A, H, N | |
Н1N1 | 24 (24.49%) | 24 (24.49%) | 24 (24.49%) | 35 (35.71%) | 35 (35.71%) | 35 (35.71%) | 36 (36.73%) |
H3N2 | 31 (31.63%) | 31 (31.63%) | 31 (31.63%) | 39 (39.80%) | 39 (39.80%) | 39 (39.80%) | 40 (40.82%) |
H3N8 | 11 (11.22%) | 11 (11.22%) | 11 (11.22%) | 14 (14.29%) | 14 (14.29%) | N/A | 14 (14.29%) |
H5N1 | 5 (5.10%) | 5 (5.10%) | 5 (5.10%) | 8 (8.16%) | 8 (8.16%) | 8 (8.16%) | 8 (8.16%) |
Positive | 71 (72.45%) | 71 (72.45%) | 71 (72.45%) | 96 (97.96%) | 96 (97.96%) | 82 (83.67%) | 98 (100%) |
Note: 98 specimens were assayed.
The findings of the study showed that by use of IAVchip DNA microarray influenza viruses were detected in all 98 samples; 36.73% of them were subtyped as influenza A virus A/Н1N1, 40.82% as A/H3N2, 14.29% as A/H3N8, and 8.16% as A/H5N1.
In the same samples influenza viruses were detected and subtyped by RT-PCR as follows: in 24.49% of samples as A/Н1N1, in 31.63% as A/H3N2, in 11.22% as A/H3N8, and in 5.10% as A/H5N1. The results of RT-PCR were positive in 72.45% samples; in 27.55% they were negative.
In the same 98 samples real-time RT-PCR detected and subtyped the following influenza viruses: A/Н1N1 in 35.71%, A/H3N2 in 39.80%, A/H3N8 in 14.29%, and A/H5N1 in 8.16% of samples. Real-time RT-PCR diagnosed influenza A virus in 97.96% of all assayed samples and showed negative result in 2.04% of samples.
IAV genome variability begets a very important diagnostic problem that consists in need of rapid and accurate method of diagnosis not only of existing but of emerging viruses for efficient influenza surveillance at the global level [
Biological microarrays are developed today in many countries. Biochips for diagnosis of the human influenza of subtypes H1N1, H3N2, including H5N1, are set forth [
There are also microarrays for identification of all IAV subtypes by both hemagglutinin and neuraminidase genes. Xueqing et al. [
On the basis of the oligonucleotide microarray IAVchip that allows detecting and subtyping IAV has been developed at the RIBSP [
Diagnostic effectiveness (DE) of the test expressed as percentage ratio of the number of true test results to the total number of findings for IAVchip DNA microarray was 99.45%, for the real-time PCR and RT-PCR; it was 98.38% and 96.22%, respectively.
The majority of authors propose in their papers using microarrays for the human influenza viruses [
Analysis of these data shows that IAVchip DNA microarray for IAV diagnosis and identification has the advantage over the other tests in effectiveness and is more rapid owing to possibility to detect and subtype several influenza A viruses simultaneously in one experiment.
It should be noted that in the course of testing clinical specimens with use of IAVchip DNA microarray in one reaction both influenza A virus identification and subtyping of tens of viruses take place during 8–10 hours. Subtype information is especially important, for example, in the South-Eastern Asia, where subtypes A/H3N2, A/H1N1, and A/H5N1 can simultaneously circulate in a body.
So, possible usage of the microarray in clinical practice for influenza A diagnosis and subtyping of the viruses isolated both from humans and from animals and birds is shown.
Influenza A virus
Hemagglutinin
Neuraminidase
True positive
True negative
False positive
False negative
Sensitivity
Specificity
Positive Predictive Value
Negative Predictive Value
Diagnostic effectiveness
95% confidence intervals.
Ethical approval was not required.
The authors declare that there is no conflict of interests regarding the publication of this paper.