A rapid and sensitive loop-mediated isothermal amplification (LAMP) assay for Cyprinid herpesvirus 2 (CyHV-2) detection in gibel carp was developed. Following cloning and sequencing of the putative DNA helicase gene of CyHV-2 isolate from China, a set of four specific primers was designed based on the sequence. The MgCl2 concentration and the reaction temperature were optimized to 6 mM, 64°C, respectively. LAMP products were detected by visual inspection of a color change due to addition of SYBR Green I stain. The specificity and sensitivity of the LAMP assay were determined. No cross-reaction was observed with other fish DNA viruses including eel herpesvirus, koi herpesvirus, and Chinese giant salamander iridovirus. The LAMP assay was found to be equally sensitive as nested PCR. A comparative evaluation of 10 fish samples using LAMP and nested PCR assays showed an overall correlation in positive and negative results for CyHV-2. These results indicate that the LAMP assay is simple, sensitive, and specific and has a great potential use for CyHV-2 detection in the laboratory and field.
Herpesviral hematopoietic necrosis (HVHN), caused by Cyprinid herpesvirus 2 (CyHV-2), is a disease of goldfish
Molecular tools such as polymerase chain reaction (PCR) and quantitative real-time PCR have been established for the detection and quantification of CyHV-2 [
Gibel carp (
Cyprinid herpesvirus 2 (CyHV-2), eel herpesvirus (AngHV-1), koi herpes virus (KHV, CyHV-3), and Chinese giant salamander iridovirus (GSIV) were isolated and kept in our laboratory.
Diseased gibel carp (15–28 cm in length) were obtained from the farms in Jiangsu province, China in May 2012. Healthy fish were obtained from the experimental station, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences.
The spleen and kidney of the diseased gibel carp with severe hemorrhagic symptoms were collected and homogenized on ice in DPBS (Sigma, USA) at a ratio of 1 : 5 w/v. After being frozen-thawed twice, the homogenate was centrifuged at 4,500 ×g for 30 min at 4°C (Sigma 3K15). 250
A PCR primer set (JF/JR) was designed to amplify the complete cds of the viral putative DNA helicase gene (GenBank accession EU349287). Then nested PCR primers (JF1/JR1, JF2/JR2) were designed for detection (GenBank accession KC245087) by software Primer Premier 5.0.
A set of four LAMP primers (JF3 and JB3, JBIP and JFIP) recognizing six distinct regions in the viral putative DNA helicase gene sequence (GenBank accession KC245087) was designed by using the Primer Explorer version 4 (
Primer names and sequences used in the study.
Primer | Sequence (5′→3′) | Position |
---|---|---|
JF | ATGTGCAACGTGACGGCGAGT | 1–21 |
JR | CTACCGTCTTTTAGGG | 1446–1431 |
JF1 | TGAAATGTCAAAAGTGGATGG | 239–259 |
JR1 | TATTCCCAGACAGCCTTCAAA | 954–934 |
JF2 | GAACACCGCTGCTCATCATC | 323–342 |
JR2 | ACTCTTCGCAAGTCCTCACC | 679–660 |
JF3 | TTGGATCTGAACGCTTCGG | 97–115 |
JB3 | CGTTGGTCTGTATGGGAGC | 286–304 |
JFIP | GCGATGTAAGCCCTGTGAGACTTTTTACGAGACGTGGTTCCTAGC | 176–197/TTTT/116–134 |
JBIP | AACGCACGAGTGCGAGTCTCTTTTGCTGTGGATCGTCCATCC | 204–223/TTTT/254–271 |
The nucleotide sequence of partial CyHV-2 DNA helicase gene used to design inner and outer primers for LAMP.
The putative DNA helicase gene of CyHV-2 was amplified by PCR. The reaction mixture contained 0.2
Nested PCR was carried out using the primers designed. The first PCR was carried out with an outer primer set (JF1 and JR1), yielding a PCR product with 716 bp. The nested PCR was performed with an inner primer set (JF2 and JR2), yielding a PCR product with 357 bp.
The PCR reactions contained 0.2
0.5
To optimize the LAMP reaction, different reaction temperatures and MgCl2 concentrations were tested. The LAMP reactions were performed using a heating block set at 60, 61, 62, 63, 64, and 65°C for 60 min, respectively. The LAMP reactions were incubated in a heating block set at 64°C for 60 min, containing 0, 2, 4, 6, 8, and 10 mM MgCl2, respectively.
The reaction mixture (25
After LAMP reaction, white turbidity of the reaction mixture by magnesium pyrophosphate (by-product of LAMP) was inspected. Visual inspection of LAMP amplification was carried out by mixing 4
The specificity of the LAMP assay to amplify only CyHV-2 DNA was tested against DNA extracted from other viruses including eel herpesvirus (AngHV-1), koi herpesvirus (KHV, CyHV-3), and Chinese giant salamander iridovirus (GSIV). Sterile ddH2O was used as a negative control. The LAMP products were analyzed by 2% agarose gel electrophoresis.
To determine the lower detection limit of the LAMP assay, 5
The use of CyHV-2 LAMP assay to detect CyHV-2 in clinical specimens was evaluated by testing a total of 5 CyHV-2 infected and 5 healthy fish, which were tested previously by nested PCR. Amplification products were analyzed by agarose gel electrophoresis.
Analysis of the viral DNA helicase gene obtained in this study showed that it was almost identical with that of the Japanese strain of CyHV-2. When the sequence alignment (BLAST) was performed, 99% nucleotide identity to the published CyHV-2 sequences (GenBank accession JQ815364, EU349287) was observed. However, these differences resulted in no alteration of the amino acid sequence (GenBank accession JQ815364), but only one amino acid alteration (GenBank accession EU349287). The sequence of the DNA helicase gene of CyHV-2 isolated from gibel carp in this study was deposited in GenBank (accession number KC245087).
The optimal LAMP reaction temperature revealed that although detectable results were observed at 62–65°C, the LAMP product amplified at 64°C exhibited slightly larger amounts of DNA as compared to others (Figure
Optimization of the LAMP reaction conditions. (a) Reaction temperature: 1–6: 60°C, 61°C, 62°C, 63°C, 64°C, and 65°C, M: DL2000 DNA marker. (b) MgCl2 concentration: 1–6: 0 mM, 2 mM, 4 mM, 6 mM, 8 mM, and 10 mM MgCl2: M: DL2000 DNA marker.
The optimal MgCl2 concentration for LAMP showed that tests with 2–8 mM MgCl2 gave detectable results but that the clearest bands were obtained with 6 mM MgCl2 (Figure
Thus, the optimal reaction conditions were 6 mM MgCl2, 64°C. In addition, because loop primers were not used, 60 min was chosen arbitrarily as the assay time, consistent with the classic report about LAMP [
The LAMP assay result showed that a typical ladder-like pattern was observed only when the CyHV-2 DNA was present. There were no amplification products detected with eel herpesvirus (AngHV-1), koi herpesvirus (KHV, CyHV-3), or Chinese giant salamander iridovirus (GSIV) genomic DNA (Figure
Specificity of the LAMP assay. 1: negative control; 2: GSIV; 3: AngHV-1; 4: KHV; 5: CyHV-2; M: DL2000 DNA marker.
The reaction was tested using 5
Sensitivity of the LAMP assay. Visual inspection in daylight (a), under UV light (b), and with 2% agarose gel electrophoresis (c). 1: negative control; 2: 10−4 dilution; 3: 10−3 dilution; 4: 10−2 dilution; 5: 10−1 dilution; M: DL2000 DNA marker.
Sensitivity of the nested PCR assay. 1–5: the first PCR products; 6–10: the second PCR products. 1, 6: negative control; 2, 7: 10−4 dilution; 3, 8: 10−3 dilution. 4, 9: 10−2 dilution; 5, 10: 10−1 dilution; M: DL2000 DNA marker.
When fish samples were tested, the LAMP assay results correlated strongly with nested PCR results for CyHV-2 detection (data not shown). The positive samples tested by nested PCR also gave positive reactions with LAMP, and no sample that was negative by nested PCR tested positive with the LAMP assay, which proved the applicability of the assay in CyHV-2 disease diagnosis.
The most classic technique for detection of viral pathogens is virus isolation by cell culture, but this technique depends on the subculture of cells and virus and is time consuming. It is reported that the CyHV-2 is very difficult to be cultured in cells [
The LAMP reaction conditions, including MgCl2 concentration and reaction temperature, were optimized first in the study. The optimal conditions of LAMP reaction for the detection were determined at 64°C for 60 min with 6 mM MgCl2.
Specificity and sensitivity are the most important parameters to evaluate an assay. LAMP assays carried out using DNA templates from AngHV-1, KHV (CyHV-3) and GSIV gave no positive results (i.e., no amplification). The results indicated that the LAMP assay was specific for CyHV-2. The detection limit of the LAMP assay was determined by amplification of 10-fold serial dilutions. The results obtained by LAMP gave comparable sensitivity to those of nested PCR at 10−3 dilution, which was in agreement with previous reports [
Use of SYBR Green I for visual inspection of LAMP results was a simple and superior technique, with no gel electrophoresis and staining with ethidium bromide required. Positive and negative reactions showed distinctly different colors in daylight on a black background [
According to known sequences, the viral DNA helicase gene used as the target in the LAMP assay is relatively well conserved, which was useful for detection of all CyHV-2 isolates. Our final goal is to exploit a simple and rapid diagnostic kit for diagnosis and monitoring of CyHV-2 in fish farms, as it does not require special equipment. Further studies are considered, such as a simple DNA extraction method by tissue boiling.
In conclusion, a simple, rapid, and sensitive LAMP assay to detect CyHV-2 in fish was developed and validated. In this simple diagnostic protocol, the reaction was carried out in a single tube and incubated for 60 min in a water bath or a heating block at 64°C. LAMP products could be detected by the naked eye with the aid of SYBR Green I stain, which could facilitate field implementation of the LAMP assay.
The authors declare that there is no conflict of interests regarding the publication of this paper.
This study was supported by the Earmarked Fund for China Agriculture Research System (CARS-46-11), the Special Scientific Research Funds for Central Non-Profit Institutes, Chinese Academy of Fishery Sciences (2013A0606), and the Director Fund of Yangtze River Fisheries Research Institute (SZ2012-03).