Enterohemorrhagic
Food contamination has been identified as a potential source of pathogenic EHEC O157 transmission in humans [
Although the prevalence of EHEC O157 in animal feces in Eastern China has been reported [
The EHEC O157:H7 reference strains ATCC35150 and ATCC43889 were used as positive controls for amplification by polymerase chain reaction (PCR) and molecular typing. All
In the present study, a total of 1100 samples, including animal fecal samples (
Primers for detection of virulence genes in EHEC O157 isolates.
Primers | Sequence (5′ |
Annealing temperature/°C | Product size/bp | Reference |
---|---|---|---|---|
|
AAGATTGCGCTGAAGCCTTTG | 55 | 497 |
[ |
|
CATTGGCATCGTGTGGACAG | |||
|
TGTCGCATAGTGGAACCTCA | 53 | 655 |
[ |
|
TGCGCACTGAGAAGAAGAGA | |||
|
CCATGACAACGGACAGCAGTT | 53 | 780 | This study |
|
CCTGTCAACTGAGCACTTTG | |||
|
GGTGAAACTGTTGCCGATCT | 50 | 1382 | This study |
|
TTGCCATTACGGTCATAGGCG | |||
|
ACGATGTGGTTTATTCTGGA | 50 | 167 | This study |
|
CTTCACGTCACCATACATAT |
The EHEC O157 virulence genes
Biofilm formation assays were performed according to the methods described in a previous report [
Strains were classified as non-biofilm producers, weak biofilm producers, moderate biofilm producers, or strong biofilm producers based on OD595 measurements of bacterial biofilms in accordance with previously described criteria [
All EHEC O157 strains were assigned to multilocus sequence types (STs) as described previously [
Based on the results obtained in preliminary experiments, only one primer, RAPD-2 (5′-TGCCCAGCCT-3′), was used for RAPD-PCR analysis of the EHEC O157 strains. Amplification reactions were performed in a 20
To compare the prevalence of EHEC O157 in animal fecal and food samples, 1100 isolates were characterized using selective media, PCR, and an anti-O157 sera agglutination assay. Of these, 30 (2.73%) EHEC O157 strains were successfully isolated from the obtained samples. As shown in Table
Number of
Source | Number of samples | Number of |
Percentage |
---|---|---|---|
|
|
|
|
Pigs | 500 | 20 | 4% |
Cattle | 60 | 2 | 3.3% |
Chicken | 140 | 2 | 1.43% |
Duck | 100 | 1 | 1% |
|
|
|
|
Pork | 140 | 3 | 2.14% |
Beef | 20 | 0 | 0 |
Milk | 60 | 1 | 1.67% |
Chicken | 60 | 1 | 1.67% |
Duck | 20 | 0 | 0 |
|
|
|
|
EHEC O157 isolates were screened for the presence of virulence genes. The distribution and combinations of virulence genes for each isolate are shown in Table
Genotypic and phenotypic characteristics of EHEC O157 isolates.
Strains | Virulence genes | MLST | Phenotypic group | RAPD type | Biofilm formation | Source | ||||
---|---|---|---|---|---|---|---|---|---|---|
|
|
|
|
Gene combinations | ||||||
ATCC35150 | + | + | + | + | G3 | ST11 | D | R1 | No | ATCC |
ATCC43889 | + | + | + | + | G3 | ST11 | D | R1 | No | ATCC |
EHEC06 | − | − | + | − | G2 | ST11 | D | R1 | No | Pig feces |
EHEC07 | + | + | + | + | G3 | ST11 | D | R1 | Moderate | Pork |
EHEC31 | + | − | − | − | G5 | ST11 | D | R1 | Weak | Pig feces |
EHEC32 | + | − | − | − | G5 | ST11 | D | R1 | Strong | Pig feces |
EHEC36 | − | + | − | − | G6 | ST11 | D | R1 | Strong | Pork |
EHEC37 | + | + | + | + | G3 | ST11 | D | R1 | No | Pig feces |
EHEC38 | + | + | + | + | G3 | ST11 | D | R1 | No | Pig feces |
EHEC39 | + | + | + | + | G3 | ST11 | D | R1 | No | Pig feces |
EHEC41 | + | + | + | + | G3 | ST11 | D | R1 | No | Pig feces |
EHEC40 | − | + | + | + | G4 | ST11 | D | R9 | Strong | Pig feces |
EHEC05 | − | + | − | + | G7 | ST88 | A | R2 | No | Pig feces |
EHEC46 | − | + | − | − | G6 | ST88 | A | R2 | No | Pig feces |
EHEC47 | − | + | − | + | G7 | ST88 | A | R2 | No | Pig feces |
EHEC09 | − | − | + | − | G2 | ST88 | D | R2 | Strong | Chicken feces |
EHEC12 | − | − | + | − | G2 | ST88 | D | R2 | Moderate | Chicken |
EHEC03 | − | − | + | − | G2 | ST641 | D | R3 | No | Chicken feces |
EHEC25 | − | − | + | − | G2 | ST641 | D | R3 | No | Pork |
EHEC43 | − | − | − | + | G1 | ST641 | D | R3 | No | Pig feces |
EHEC45 | − | − | − | + | G1 | ST641 | D | R3 | No | Pig feces |
EHEC16 | − | − | − | + | G1 | ST117 | D | R4 | Weak | Cattle feces |
EHEC18 | − | + | + | + | G4 | ST117 | D | R4 | Weak | Pig feces |
EHEC30 | − | − | − | + | G1 | ST117 | D | R4 | Weak | Milk |
EHEC44 | − | − | − | + | G1 | ST10 | A | R10 | No | Pig feces |
EHEC02 | + | − | − | + | G8 | ST224 | D | R2 | Weak | Pig feces |
EHEC15 | − | − | + | − | G2 | ST278 | B1 | R2 | No | Cattle feces |
EHEC28 | − | − | − | − | G9 | ST1114 | B2 | R4 | Moderate | Pig feces |
EHEC27 | − | − | − | + | G1 | ST1602 | A | R8 | Strong | Pig feces |
EHEC01 | − | − | + | + | G19 | Unknown | B2 | R5 | Moderate | Pig feces |
EHEC08 | − | + | + | + | G4 | Unknown | B2 | R6 | Weak | Duck feces |
EHEC26 | − | − | − | + | G1 | Unknown | D | R7 | Strong | Pig feces |
The ability of EHEC O157 isolates to form biofilm in polystyrene microtiter plates was assessed according to OD595 values. The results indicated that biofilm formation occurred in 16 (53.3%) of the EHEC O157 strains after a 24 h incubation at 37°C (Figure
Biofilm formation by EHEC O157 isolates. Biofilm formation by EHEC O157 isolates on polypropylene microtiter plates following incubation for 24 h at 37°C in LB broth without salt (LB-NS). All experiments were repeated at least three times. The columns represent the mean ± standard deviations of the data. Comparisons of the OD values produced by bacterial biofilms to the ODc values were used to classify the strains (non-biofilm producer, weak, moderate, or strong). The cut-off OD (ODc) value was defined as three standard deviations above the mean OD of a blank control. Strains were classified as follows: OD < ODc = no biofilm production; ODc < OD < (2 ODc) = weak biofilm producer; (2 ODc) < OD < (4 ODc) = moderate biofilm producer; and (4 ODc) < OD = strong biofilm producer.
Of the individual typing techniques used in this study, phylogenetic typing showed that most of the O157 isolates belonged to group D (70%). Only 16.7% (5/30) of the strains belonged to group A, 10% (3/30) to B2, and 3.3% (1/30) to B1 (Table
Among 30 EHEC O157 isolates analyzed by MLST, 27 strains generated sequence tracings acceptable for an ST number available from the online MLST database (
RAPD analysis showed that the isolates formed 10 RAPD types (R1–R10) with bands ranging from approximately 200 to 2100 bp. A total of 9 (30%) EHEC O157 isolates were grouped into RAPD type R1. RAPD types R2, R3, and R4 were composed of 7 (23.3%), 4 (13.3%), and 4 (13.3%) isolates, respectively. The other RAPD types, R5–10, were composed of a single isolate. The predominant RAPD types were EHEC O157 from pig feces and pork samples (Table
EHEC O157 is an important emerging zoonotic foodborne pathogen that can cause gastroenteritis often complicated by HC or HUS in humans [
In the present study, EHEC O157 was successfully isolated from 2.73% (30/1100) of the tested animal feces and food samples. Among the 30 EHEC O157 isolates, 20 (66.7%) strains were isolated from pig feces, 3 (10%) from pork, 2 (6.67%) from cattle feces, 2 (6.67%) from chicken feces, and one each from duck feces, milk, and chicken meat, respectively. Reportedly, the proportion of EHEC O157 is often higher in pig feces and pork than in cattle feces and beef [
The pathogenesis of EHEC O157 is associated with several virulence factors, such as Shiga toxin 1 and 2 (encoded by
Our findings indicated that the use of molecular typing provides valuable information that may also be useful in pinpointing sources of food contamination [
Composite analysis of all three molecular typing methods revealed a relationship between the phylogenetic group and MLST and RAPD typing. For example, the largest cluster of MLST type (ST11) was comprised mainly of strains belonging to ECOR group D and RAPD type R1. In fact, all of the R1 type isolates were identified as ST11 and ECOR group D. Molecular characterization of EHEC O157 showed that the isolates from fecal and food samples were clustered into the same predominant group, indicating that animal feces might be a reservoir for EHEC O157. Thus, close monitoring of possible food contamination by EHEC O157 should be reinforced.
Biofilm formation aids in the survival of bacteria and enhances their ability to survival in environment. Thus, the ability of the EHEC O157 isolates to form biofilms was assessed in this study. The results indicated that biofilm formation occurred in 16 (53.3%) of the EHEC O157 strains after 24 h of incubation at 37°C. However, the composite analysis between molecular typing and biofilm formation revealed that biofilm formation of EHEC O157 was independent of the three molecular genetic typing methods used in this study, which was consistent with the conclusions of another study [
EHEC O157 was isolated from fecal and food samples and then characterized. The results showed that isolates from fecal and food samples harbored the same gene combinations. Moreover, these isolates were clustered into the same molecular typing group, indicating that animal feces are reservoirs of EHEC O157. Thus, it is important to control food contamination with EHEC O157 on farms and in abattoirs to reduce the incidence of foodborne infections in humans.
None of the authors had any conflict of interests in the writing of this paper.
This work was supported by a grant from the National Natural Science Foundation of China (81201266) and The National Basic Fund for Institutes, which is supported by Shanghai Veterinary Research Institute (2013JB05). The authors wish to thank Mr. Qiuhua Zhao from the Minhang Center of Animal Disease Prevention and Control (Shanghai, China) for supplying the animal fecal samples.