The purpose of this paper was to check if viable bacteria, in particular lactic acid bacteria (LAB), could be enriched from biopsies obtained from healthy gastroscopy patients.
Gastric biopsies were obtained from 13 gastroscopy patients and subjected to an anaerobic or microaerophilic enrichment procedure utilizing the Portable Microbe Enrichment Unit (PMEU). Profuse microbial growth was observed in most cases. Samples plated on MRS showed high numbers of LAB. The most common species characterized were
Although a diverse bacterial biota has been detected in the human esophagus [
While the bacterial densities in stomach undoubtedly are considerably lower than those detected in the ileum and colon, the possibility of acid-tolerant bacteria being continuously present on the gastric mucosal surfaces cannot be excluded. Lactic acid bacteria (LAB) are particularly interesting in this respect, because of the demonstrated positive health effects of certain LAB strains as probiotic microorganisms [
Altogether, thirteen subjects were recruited for the study among patients coming to normal diagnostic gastroscopy. The subjects had a normal Western diet and did not receive any medication that might interfere with gastrointestinal microbiota. Fasting overnight was the standard routine of the procedure. Biopsies were taken from the cardial, antrum, and pyloric regions of the stomach.
The enrichment was done using the PMEU technology (Portable Microbe Enrichment Unit, Finnoflag Oy and Samplion Oy, Kuopio and Siilinjärvi, Finland, Figure
Portable Microbe Enrichment Unit (Samplion Oy).
In the present experiment the PMEU unit was adjusted to either anaerobic or microaerobic cultivation mode using continuous gas flow into the medium. The anaerobic gas mixture consisted of 80% N2, 10% CO2, and 10% H2 whereas the composition of the microaerobic gas flow was 5% O2, 10% CO2, and 85% N2. The pre-enrichment periods varied between 22 and 23.5 (for anaerobic cultures), and between 23.5 and 24 hours (for microaerobic cultures) at 37°C.
The cultivable bacterial counts after pre-enrichment were studied by plating dilution series of the enrichment onto Petri dishes and cultivating them anaerobically at 37°C on Man-Rogosa Sharpe (MRS; Lab M, UK) agar (for lactic acid bacteria 72 h), on Plate Count (PC; Lab M, UK) agar (48 h), and on Wilkins Chalgren (Oxoid, UK) agar (for the
The cells from the most dominant isolates on the basis of colony morphology on MRS plates were Gram stained and observed microscopically. The Gram-positive rods or cocci were further subjected to tentative identification by API CH50 profiling (bioMérieux SA, France), followed by 16s DNA sequencing. Total genomic DNA was extracted from biopsy samples by using Charge Switch gDNA Mini Bacteria Kit (InVitrogen, USA). The primers used for the amplification were the archael 16S rDNA gene primers 27F (TCCGGTTGATCCTGCCGGAG) and 685R (TTACGGGATTTCACTCCTAC) yielding a 650 bp fragment. PCR amplifications were performed in a final volume of 50
The study plan was reviewed and approved by the Ethical Committee of the Kuopio University Hospital.
None of the patients recruited in the study proved to have
As can be seen in Table
The CFU counts recovered from the gastric biopsies.
Patient number | Enrichment conditions | log CFU mL−1 mediuma | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
Site of the biopsy | ||||||||||
Cardia | Antrum | Pylorus | ||||||||
Plate count agar | MRS agar | Wilkins Chalgren agar | Plate count agar | MRS agar | Wilkins Chalgren agar | Plate count agar | MRS agar | Wilkins Chalgren agar | ||
1 | Anaerobic | 8.9 | 9.0 | 8.0 | 8.5 | 8.7 | 8.1 | 8.5 | 8.7 | 8.0 |
2 | Anaerobic | 8.3 | 8.1 | 7.0 | <5.0 | 5.3 | <5.0 | <5.0 | <5.0 | <5.0 |
3 | Anaerobic | 8.2 | 8.3 | <5.0 | <1.0 | <1.0 | <1.0 | <1.0 | <1.0 | <1.0 |
4 | Anaerobic | 9.2 | 8.3 | 5.9 | 8.9 | 7.5 | <5.0 | <1.0 | <1.0 | <1.0 |
5 | Microaerophilic | 8.0 | 8.4 | 7.6 | 8.2 | 8.3 | 6.6 | 8.2 | 8.2 | 6.6 |
6 | Microaerophilic | 8.0 | 8.0 | 8.0 | 8.4 | 8.1 | 7.1 | 8.5 | 8.5 | 8.1 |
7 | Microaerophilic | 8.5 | 8.0 | 8.5 | 8.4 | 8.3 | 8.3 | 7.8 | 8.5 | 8.4 |
8 | Microaerophilic | 8.6 | 8.8 | 4.7 | 8.5 | 8.6 | 5.3 | 8.5 | 8.5 | 6.9 |
9 | Microaerophilic | 8.1 | 8.1 | 8.1 | <1.0 | 5.8 | <1.0 | 8.3 | 8.1 | 5.8 |
10 | Microaerophilic | 8.6 | 8.1 | 8.0 | 7.8 | 8.0 | 5.7 | 8.4 | 8.4 | 6.6 |
11 | Microaerophilic | 6.1 | 6.0 | <5.0 | 8.1 | 8.5 | 6.4 | 8.0 | 7.6 | <5.0 |
12b | Microaerophilic | 9.3 | 8.6 | ndc | 8.3 | 8.3 | nd | 7.9 | 8.0 | nd |
13b | Microaerophilic | <2.0 | 6.2 | nd | 6.6 | 6.6 | nt | 6.3 | 6.4 | nd |
a< in front of the log means values below the detection limit in the particular experiment.
bThe plating and incubation of these samples were done in aerobic conditions.
cnd = not done.
Background values of CFU counts from the enrichment culture before the enrichment step.
Patient number | Plating conditions | log CFU mL−1 mediuma | |||||
---|---|---|---|---|---|---|---|
Site of the biopsy | |||||||
Cardia | Antrum | Pylorus | |||||
Plate count agar | MRS agar | Plate count agar | MRS agar | Plate count agar | MRS agar | ||
11 | Anaerobic | 6.1 | 6.0 | 5.3 | 4.2 | 2.3 | 3.1 |
12 | Anaerobic | 3.0 | <2.0 | 2.8 | 2.8 | 3.1 | 3.3 |
Aerobic | 2.2 | <2.0 | 3.0 | 3.2 | 3.5 | 3.0 | |
13 | Anaerobic | <2.0 | <2.0 | <2.0 | <2.0 | <2.0 | <2.0 |
Aerobic | <2.0 | <2.0 | 3.1 | <2.0 | <2.0 | <2.0 |
a< in front of the log means values below the detection limit in the particular experiment.
The colonies on MRS plates typically represented morphologically one to three dominant types. These were further characterised and the species distribution, as indicated by the 16S rDNA sequence is given in Table
The identified LAB species enriched from the biopsies obtained from different gastric sites.
Patient number | Cardia | Antrum | Pylorus |
---|---|---|---|
1 | |||
2 | |||
4 | |||
5 | |||
6 | |||
7 | |||
8 | |||
9 | |||
10 | |||
11 | |||
12 | |||
13 |
aThe number in parenthesis is the number of isolates if more than one.
The PMEU technology has been previously successfully applied to enrich microorganisms from samples where their numbers are low [
On the basis of the limited data it cannot be stated, whether there is any preference for the bacterial presence regarding the different parts of the stomach (cardia, antrum, or pylorus).
Without the enrichment step the recovered bacterial counts were low, occasionally below the detection limit, indicating that cultivable mucosa-associated bacteria are rare, as can be expected. However, they can be found at least after the enrichment, and the question arises, whether they, including the ones originally ingested with food or saliva, represent some type of adaptation to gastric conditions. Since the focus of this study was on LAB, the colonies from Plate Count or Wilkins-Chalgren plates were not analysed further. These media were included to get an idea of the total amount of bacteria in the enrichment broth and whether there is some variability in the species composition that is reflected on differential growth on one of these media. The fact that the CFU counts on Wilkins-Chalgren medium were often (but not always) lower than on other media may indicate species differences between different individuals, particularly among anaerobes.
Gastric environment is a challenge regarding the possibilities of probiotic therapy. For example, although some indication of beneficial effects of probiotics on
With a proper design of the enrichment conditions (composition and the pH of the medium) potential probiotic candidates could be isolated also from the gastric environment.
The authors wish to thank Mrs. Anneli Heitto, M.S., Mrs. Mirja Rekola, and Mrs. Elvi Mäkirinne for technical assistance.