Herpesvirus 6 (HHV-6) infection is a common complication during immunosuppression. Its significance for multiple myeloma (MM) patients undergoing autologous stem cell transplantation (ASCT) after treatment with novel agents affecting immune system remains undetermined. Data on 62 consecutive MM patients receiving bortezomib-dexamethasone (VD) (
Human herpesvirus 6 (HHV-6) is highly prevalent in humans, infecting almost all children during their early childhood [
Unlike Allo SCT, autologous stem cell transplantation (ASCT), being associated with mild transient immunodeficiency, has been traditionally considered a less probable cause of HHV-6 reactivation. However, studies exploring this risk in heterogeneous groups of autografted patients reported a similarly high risk for HHV-6 infection [
Induction therapy for myeloma has changed dramatically over the last few years and the traditional VAD (vincristine, doxorubicin, dexamethasone) has been substituted with thalidomide, bortezomib, and lenalidomide-based regimens [
This leads to an increased incidence of herpes Zoster infection in patients receiving bortezomib, which is reported to approach 13% [
The incidence of HHV-6 infection has not yet been studied in a large homogenous group of autografted MM patients. Furthermore, a potential adverse effect of pretransplant administration of novel biological agents on transplant-related HHV-6 infection has not been explored.
The current study was designed to assess the incidence, clinical significance, and risk factors for HHV-6 reactivation in a large cohort of myeloma patients, consecutively treated with novel agents and ASCT.
The study was approved by the Institutional Review Board (IRB) of the Rambam Health Care Campus (approval no. 0380-11RMBG).
The departmental transplant database was searched for all myeloma patients, aged 18 years or older, who underwent autologous stem cell transplantation after receiving a thalidomide or bortezomib-based therapy, completed within less than 2 months to prior transplant. Patients who received VT or TD as their second line pretransplant therapy were not included, unless they completed first therapeutic regimen, at least 6 months prior to the initiation of TD/VD. Patients receiving a second ASCT, performed in a tandem setting or at disease progression, were not included in this study. Data on induction therapy and transplant-related complications (particularly, infectious, neurological, and respiratory) were obtained from original computerized medical files.
Pretransplant treatment protocols included in the current study were VD (intravenous bortezomib 1.3 mg/m2 on days 1, 4, 8, 11, and dexamethasone 40 mg on the days of bortezomib administration) and TD (p.o. thalidomide 100–200 mg daily, administered together with dexamethasone).
The transplant conditioning regimen was melphalan 200 mg/m2, administered over 1 day. All transplanted patients received anti-herpes-zoster prophylaxis with acyclovir 200 mg four times per day, started on day +1 after transplant and continuing up to 90 days.
According to the department protocol, patients with persistent fever (temperature >38°C for ≥3 days), occurring after neutrophil engraftment (>500) or beyond day 16 after transplant, in whom detailed investigation for a causative pathogen (multiple blood cultures, polymerase chain reaction (PCR) for aspergillus, serologic test for galactomannan, and chest CT scan) failed to detect bacterial or fungal infective cause, underwent a molecular investigation for viral infection, including PCR tests of peripheral blood (PB) for cytomegalovirus (CMV), Epstein-Barr virus (EBV), adenovirus, and HHV-6. Patients exhibiting lower or upper respiratory symptoms were also screened for respiratory viruses, using PCRs for influenza (A, B, H1N1), parainfluenza viruses types 1, 2, 3, RSV, and adenovirus, examined in respiratory secretions. Notably, criteria for performing virology screen remained unchanged during the study period.
PCR for HHV-6 was repeated only if patient’s symptoms (including fever) had not resolved within one week from HHV-6 diagnosis.
Diagnosis of HHV-6 reactivation was made in the presence of any level of HHV-6 DNA in blood [
Notably, the PCR test, described below, was shown to be highly sensitive (100%) and highly specific, with no false positive events, attributed to concurrent bacterial and viral infections [
DNA was extracted from patient’s whole blood samples (200
DNA was amplified by conventional nested PCR [
nPCR reaction was performed in 25
The primers and probe were targeted—U6 gene. (Forward primer: 5′ AAAATTTCTCACGCCGGTATTC 3′; reverse primer: 5′ CCTGCAGACCGTTCGTCAA 3′; probe—6-FAM-TCGGTCGACTGCCCGCTACCA-BHQ). PCR reaction was performed in a total volume of 25
Analysis was performed using SPSS 18.0 software. As data were not normally distributed according to Kolmogorov-Smirnov test, quantitative variables were analyzed by Mann-Whitney
Sixty-two consecutive patients, 21 (33%) who received pretransplant TD and 41 (66%) who had VD, were analyzed. The median age at SCT for the whole series was 56.5 years (35–67 years). Characteristics of the patient group as a whole and depending on pretransplant induction regimen are presented in Table
Clinical characteristics of the group as a whole (
Whole group |
VD cohort |
TD cohort |
| |
---|---|---|---|---|
Sex (male) | 36 (58%) | 25 (61%) | 11 (52%) | n.s. |
Median age, years (range) | 56.5 (35–67) | 58 (35–67) | 56 (45–64) | n.s. |
Median time from diagnosis to SCT, months (range) | 9 (4–60) | 8 (4–36) | 10 (7–60) | 0.024 |
Median accumulative steroid dosage, mg (range) | 800 (320–4320) | 640 (320–3680) | 1000 (320–4320) | 0.024 |
Twenty-six patients, 8 treated with TD and 18 treated with VD (
Clinical characteristics of screened patients (
VD |
TD |
| |
---|---|---|---|
Sex (male) | 9 (50%) | 4 (50%) | |
Median age, years (range) | 55 (35–67) | 54 (45–63) | n.s. |
Disease status | CR; 2 | ||
PR: 1 | PR: 5 | ||
VGPR: 9 | VGPR: 2 | ||
Unknown: 6 | Unknown: 1 | ||
Median time from diagnosis to SCT, months (range) | 7 (5–28) | 9.5 (7–24) | n.s. |
Median accumulative steroid dosage, mg (range) | 640 (480–3680) | 880 (320–4320) | 0.022 |
Cohort diagram.
HHV-6 reactivation was revealed in ten patients (median age 57 years; range 49–67 years), within 14 to 26 days after transplant (median 17 days).
The incidence of reactivation in the whole cohort approached 16%: 19.5% (8/41) in the VD cohort, compared to 9.5% (2/21) in the TD group (
Notably, the cumulative steroid dose in patients diagnosed with HHV-6 reactivation was higher than recorded in screened HHV-6 negative subjects (880 mg versus 640 mg,
All patients diagnosed with reactivation of HHV-6 presented with high, unexplained fever.
Causes for fever in patients undergoing a virology screen, in whom HHV-6 was found to be negative, were considered as Hickman-related infection (resolving shortly after removal of Hickman catheter,
Six of the 10 patients (60%) diagnosed with HHV-6 reactivation, were actually defined as having an HHV-6 disease, presenting with asymptomatic respiratory involvement, detected by chest CT scans, which demonstrated non-specific lung infiltrations. Notably, 3 of these 6 patients had a high level of HHV-6 reactivation.
None of the patients diagnosed with HHV-6 reactivation developed delirium or any other clinically significant neurological manifestations, and none of the patients had a skin rash.
The median time for neutrophil and platelet engraftment was similar for patients diagnosed with HHV6 infection versus the “negative” screened cohort, approaching 12 versus 14 days and 14 versus 15 days, respectively.
As expected, all patients were severely lymphopenic at the time of reactivation (absolute lymphocyte count < 500/
Infection-related symptoms self-resolved within one week after diagnosis in 9 patients, none of whom developed a concurrent opportunistic infection.
One patient, experiencing prolonged fever (>1 week) since diagnosis of high-level HHV-6 reactivation (120,000 copies/
A long-term evaluation, performed within a median followup of 494 days (range 14–2437) after autograft showed that 49 patients were alive, including 10 of the HHV-6 positive subjects (100%), 5 of the HHV-6 negative screened subjects (31%), and 8 of the nonscreened subjects (25%). None of the patients in the entire cohort had clinically significant long-term neurological sequels.
Univariate analysis of patients undergoing virology screen due to an unexplained fever following engraftment, found the exposure to a higher steroid dose to be the only statistically significant factor for HHV-6 infection (Table
Risk factors for HHV6 reactivation after autologous SCT*.
HHV-6 positive ( |
HHV-6 negative ( |
| |||
---|---|---|---|---|---|
Age | 57 (49–67) | 53 (35–63) | n.s. | ||
Male | 7 (70%) | 6 (37.5%) | n.s. | ||
Female | 3 (30%) | 10 (62.5%) | n.s. | ||
Median time from diagnosis to SCT, months (range) | 8.5 (6–28) | 7 (5–19) | n.s. | ||
| |||||
Induction regimen* | VD | TD | VD | TD | |
8 (44%) | 2 (25%) | 10 (54%) | 8 (75%) | n.s. | |
| |||||
Median accumulative steroid dosage, mg (range) | 880 (640–1600) | 640 (320–4320) | 0.038 | ||
Pretransplant lymphocyte count (cells/ |
1045 | 730 | 0.24 |
*Calculation represents the proportion of HHV-6 infection in screened patients that were treated with the same induction regimen (VD or TD, resp.).
The prevalence and significance of HHV-6 reactivation in patients undergoing ASCT have not been fully elucidated [
Bortezomib has been reported to induce T-cell inactivation [
The current retrospective study explored the incidence and clinical significance of HHV-6 reactivation in 62 consecutive MM patients undergoing ASCT, after receiving induction therapy with either thalidomide or bortezomib. Notably, there were no statistically significant differences in characteristics of patients receiving VD versus TD, apart from a higher cumulative steroid dose in those receiving thalidomide. Twenty-six (42%) patients, 18 in the VD cohort (44%) and 8 in the TD group (38%), experienced a post-engraftment “unexplained” fever, hence, underwent a PCR virology screen. Ten patients (16.5%) were diagnosed with HHV-6 reactivation. This incidence appears to be lower than previously reported in autografted patients [
As mentioned earlier, previous studies looked at heterogeneous groups of autographed patients treated in the prenovel agent era; hence, their data are barely comparable with ours [
All the ten patients diagnosed with HHV-6 reactivation, presented with high unexplained fever, in the absence of other opportunistic infections, except for one subject, who had concurrent reactivation of CMV, a phenomenon recently described by Zerr et al. [
However, the conclusion regarding the relatively innocent course of HHV-6 reactivation in autografted MM patients, previously treated with biological agents affecting immune function, should be considered with caution, given the retrospective nature of the study, the small number of evaluated patients, and the relatively short-term followup after transplant, which may interfere with proper evaluation of long-term infection-related sequels.
Nevertheless, despite the mild clinical course of HHV-6 in this setting, HHV-6 reactivation appeared to be responsible for a significant number of “post-engraftment unexplained febrile episodes,” emphasizing the significance of searching for this pathogen as a potential cause for fever.
Eight patients in the VD group and 2 in the TD cohort, accounting for 19.5% of the VD versus 9.5% of the TD series, developed HHV-6 reactivation. In a similar vein, the incidence of HHV-6 in tested VDs was higher than in tested TDs (44% versus 25%), despite screening a comparable proportion of patients in both treatment groups (44% in the VD versus 36% in the TD,
Treatment with bortezomib has been reported to be uniquely associated with an increased risk for varicella-zoster virus (VZV) infection [
Consistent with our results, exposure to steroids was reported to significantly increase the risk for herpetic diseases, particularly herpes zoster [
It is noteworthy that the low incidence of HHV-6 reactivation observed in patients receiving thalidomide may reflect induction of immunomodulation, rather than immunodeficiency [
The current study, investigating the incidence and clinical significance of HHV6 reactivation in a large cohort of homogenous transplanted MM patients, suggests HHV-6 is a significant cause of unexplained post-engraftment fever. Although the infection is almost always self-resolving, its detection could exclude the necessity for additional investigations and help in the management of such patients. The findings may suggest bortezomib is a potential risk factor of HHV-6 reactivation development, emphasizing the need for further large prospective studies to confirm this observation.
Neither author has any conflict of interests.
N. Horowitz and I. Oren contributed equally to this work.