miRNAs play an important role in several biological processes. Here, we investigated miR-320 in glucose-induced augmented production of vasoactive factors and extracellular matrix (ECM) proteins. High glucose exposure decreased the expression of microRNA 320 (miR-320) but increased the expression of endothelin 1 (ET-1), vascular endothelial growth factor (VEGF), and fibronectin (FN) in human umbilical vein endothelial cells (HUVECs). Transfection of miR-320 mimics restored ET-1, VEGF and FN mRNA, and protein expression in HUVECs treated with high glucose. Furthermore, miR-320 mimic transfection reduced glucose-induced augmented production of ERK1/2. Data from this study indicates that miR-320 negatively regulates expression of ET-1, VEGF, and FN through ERK 1/2. Identification of such novel glucose-induced mechanism regulating gene expression may offer a new strategy for the treatment of diabetic complications.
microRNA- (miRNA-) mediated regulation of gene expression has emerged as a major mechanism in regulating basal and stress-induced alterations of gene expression in several diseases [
Recent data from several laboratories have emerged with respect to miRNA alterations in diabetic complications [
In diabetes, glucose induced augmented expression of vasoactive factors and ECM proteins are important mechanisms causing tissue damage [
In this study, we focused on a specific miRNA, that is, miR-320, which demonstrated glucose-induced downregulation. miR-320 has been found to have widespread biological effects as it regulates multiple important molecules. Its potential targets include ET-1, ERK1, VEGF, and FN (
All reagents were purchased from Sigma (Oakville, ON, Canada) unless specified. HUVECs were obtained from Bio-Whittaker (San Diego, CA, USA) and plated in complete endothelial growth medium supplemented with 5% fetal bovine serum, endothelial cell growth supplement (Bio-Whittaker), and 100 ug/mL penicillin/streptomycin. Cells were plated at a density of
Total miRNAs were extracted from HUVECs using the mirVana miRNA isolation kit (Ambion, Inc., Austin, TX, USA), according to the manufacturer’s instruction. Briefly, the cells were collected and lysated in the Lysis/Binding solution. miRNAs additive (1 : 10) were added to the lysate and incubated for 10 minutes on ice. And equal volume acid-phenol : chloroform was added to the lysate. Following centrifugation and removal of the aqueous phase, the ethanol was added into the mixture. The mixture was passed through the filter cartridge and was eluted with elution solution.
miRNA expression profiling was performed following the protocol provided by the manufacturer (Life Technologies, ON, Canada). In brief, 1 ug of isolated total miRNAs was added with Megaplex RT primer, dNTPs, MultiScribe reverse transcriptase, RNase inhibitor, and buffer to perform megaplex reverse transcription. Following reverse transcription, the real-time PCR reactions mixture was prepared to mix the Megaplex RT product with TaqMan universal pCR master mix, No AmpErase UNG (2x). The real-time PCR reactions mixture was dispensed into each port of the TaqMan microRNA array card to run the array using the 384-well TaqMan low-density array default thermal cycling conditions in the 7900HT system (life Technologies, ON, Canada). The results were shown using relative quantification (
miRNAs were isolated using mirVana RT-PCR miRNA isolation kit. RT was performed after isolating of miRNA (Ambion Inc., Austin, TX, USA). TaqMan real-time PCR was used to analyze the expression of miR-320 by using miR-320 assay (Ambion Inc., Austin, TX, USA) following manufacture’s instruction. The data were normalized to U6 snRNA to account for differences in reverse-transcription efficiencies and amount of template in the reaction mixtures.
RNA was extracted with TRIzol reagent (Invitrogen Canada Inc., ON, Canada) as previously described (total RNA (2
Oligonucleotide sequences for RT-PCR.
Gene | Sequence (5′ → 3′) |
---|---|
ET-1 | 5′AAGCCCTCCAGAGAGCGTTAT3′ |
5′CGAAGGTCTGTCACCAATGT3′ | |
6FAM-TGACCCACAACCGAG-GBNFQ | |
| |
FN-1 | 5′GATAAATCAACAGTGGGAGC3′ |
5′CCCAGATCATGGAGTCTTTA3′ | |
| |
VEGF | 5′TCCTCACACCATTGAAACCA3′ |
5′GATCCTGCCCTGTCTCTCTG3′ | |
| |
|
5′CATCGTACTCCTGCTTGCTG3′ |
5′CCTCTATGCCAACACAGTGC3′ |
The cells were washed with PBS and lysed with ice-cold RIPA lysis buffer (Upstate, Temecula, CA, USA). Cell lysates were loaded to 10% SDS-PAGE gel and blotted with high-affinity rabbit polyclonal anti-ERK1/2 antibody (Cell Signaling Technology Inc., Danvers, MA, USA) followed by incubation with goat antirabbit secondary IgG antibody with horseradish peroxidase conjugate (Santa Cruz Biotechnology, Inc., CA, USA) using 1 : 5000 dilutions. Immunopositive bands were visualized with enhanced chemiluminescence advance Western blot detection system (Amersham Biosciences, Piscataway, NJ, USA). Blots were stripped and reprobed with
Supernatants were collected from HUVECs cultured for FN, ET-1, and VEGF detection by ELISA. ELISA for FN was performed using a commercially available kit (Abcam, Cambridge, MA, USA) according to the manufacturer’s instructions. Similarly, ET-1 and VEGF were measured using specific ELISA kit (Biomedica Medizinprodukte GmbH & Co KG, Wien, Austria) following the manufacturer’s instructions.
All experimental data are expressed as means ± SE and were analyzed by ANOVA or Student
Hyperglycemia is a key initiating factor for endothelial damage in diabetes. To identify underlying mechanisms of tissue damage, we initially analyzed miRNAs in ECs exposed to 5 mM (simulating euglycemia, LG) and 25 mM (simulating hyperglycemia, HG) glucose, using an miRNA PCR-array. Twenty-five mM glucose exposure for 24 hrs caused significant downregulation of 20 miRNAs and upregulation of 24 miRNAs.
Using open-sourced softwares (
(a) 25 mM D-glucose (HG) caused decreased miRNA-320 expression in the endothelial cells compared to 5 mM D-glucose (LG) by real-time RT-PCR. (b) Similarly, diabetes caused reduced miR-320 expression in the kidney. (miRNA expressed as a ratio of U6 snRNA (U6).
We then wanted to see whether such changes are indeed of significance in a clinically relevant model of diabetic complication. To this extent, we examined renal cortical tissues from STZ diabetic rats, one month after onset of diabetes, as increased ECM proteins along with augmented ET-1 and VEGF production are known to occur in diabetic nephropathy. Diabetic animals showed hyperglycemia, glucosuria, and reduced body weight gain (data not shown). Analyses of miR-320 levels demonstrated a significantly reduced miR-320 level in the renal cortex of these animals (Figure
To establish a cause-effect relationship, we again used HUVECs as an
In parallel to decreased miR-320 level upon exposure to HG, mRNA levels of ET-1 and VEGF (measured by qRT-PCR) were increased. Such increases were prevented by miR-320 mimic transfection (Figure
HG caused increased (a) FN mRNA, (b) ET-1, and (c) VEGF expression by real-time RT-PCR in the HUVEC. HG-induced increased FN, ET-1, or VEGF mRNA expression was prevented following miR-320 mimic transfection. But not by scrambled (S) mimic transfection (HG: 25 mM D-glucose, LG: 5 mM D-glucose.,
As microRNAs are posttranslational modifiers, we further examined protein levels of FN and ET-1 using ELISA. In keeping with RNA data miR-320 transfection prevented glucose induced upregulation of FN and ET-1. No effects were seen when cells were transfected with scrambled mimic (Figure
HUVECs exposed to 25 mM glucose (HG) compared to 5 mM glucose (LG) showed (a) increased FN protein and (b) increased in ET-1 protein. Transfection of endothelial cells with miR-320 mimics (but not the scrambled mimics) reduced glucose induced upregulation of FN and ET-1 protein levels. (S: scrambled miRNA, miR-320: miR-320 mimic, *significantly different from LG,
As mentioned earlier, ERK1/2 activation plays a significant role in increased vasoactive factor and ECM protein production in diabetes through PKC activation or through ET-1. Furthermore, miR-320 targets ERK. Hence, we used Western blot using antibodies against total and Phospho-ERK. miR-320 mimic transfection significantly reduced ERK1/2 protein levels and glucose induced ERK1/2 phosphorylation (Figure
25 mM glucose (HG) caused increased expression of total ERK1/2 (ERK) and phosph-ERK1/2 proteins in the HUVECs, compared to 5 mM glucose (LG). Such increases were prevented by miR-320 mimic transfect ion. (S = scrambled mimics).
In this study, we demonstrated that miR-320 is downregulated following glucose exposure to the endothelial cells and in the kidneys of diabetic rats. We have further showed that glucose induced upregulation of multiple vasoactive factors and extracellular matrix protein FN are regulated by miR-320. We also demonstrated that such regulations possibly work through MAPK modulation.
Following initial identification by a PCR-based microarray, we validated glucose induced downregulation of miR-320 in the endothelial cells. We also found that such downregulation is present in the kidneys of diabetic rats. We then demonstrated functional significance of these changes at the mRNA and protein levels using miR mimic transfection and normalization of glucose-induced upregulation of specific transcript. Our data indicated a role of ERK1/2 in this process. We used HUVECs to identify the
miRNAs highly conserved molecules across the species. They are produced as small, nonprotein coding RNAs and mostly negatively regulate gene expression at the posttranscriptional level by interacting with their target mRNA 3′ untranslated region (UTR) [
As we start to understand functions of various miRNAs, with their widespread role in biological processes, several of them appear to play significant roles in chronic diabetic complications. We have previously demonstrated the role of miR-133a in diabetic cardiomyopathy [
In summary, we have identified a specific miRNA, that is miR-320 in the endothelial cells exposed to high glucose. We have also demonstrated that miR-320 is important in the regulation of several transcripts of interest in chronic diabetic complications. Understanding such novel pathways will help to better understand pathogenesis of chronic diabetic complications and pave the pathways toward the development of novel adjuvant treatment.