Tobacco use has steadily declined over the last four decades [
Next-generation sequencing has yielded important insights into the pathogenesis of other cancers by identifying biomarkers and therapeutic targets. High-throughput sequencing of HNSCC tumors has recently been reported, and NOTCH inactivation was the most significant finding [
Ethics approval was obtained from Western University Health Sciences Research Ethics Board. Informed consent was obtained from patients undergoing ablative surgery for head and neck cancer to have a portion of their tumor stored, a 10 mL blood sample taken, and their clinical parameters prospectively collected. Two patients were identified for this pilot study: a 49-year-old nonsmoking male with a T2N0 tonsillar cancer treated with transoral robotic surgery and neck dissection and an 81-year-old female with a history of heavy smoking with a T2N0 oral tongue cancer treated with partial glossectomy, neck dissection, and free flap reconstruction. Primary site tumor specimens were taken from the center of the resection specimen. Ten mL of venous blood were drawn intraoperatively into heparinized collection tubes.
For each patient, a portion of the primary tumor was fixed in formalin and embedded in paraffin. The blocks were then sectioned (5
DNA was extracted from 10 mL of whole blood using the QIAmp Blood Maxi kit following instructions provided by the manufacturer (Qiagen, Valencia, CA, USA). DNA was extracted from approximately 25 mg of primary tumor using the AllPrep DNA/RNA/Protein kit (Qiagen).
Slides were deparaffinized by immersion in xylene, rehydrated in alcohol, and rinsed in water. Slides were then treated with 20
Patient DNA was extracted from thin section tissue slices. Briefly, a single pathology slide from each patient was deparaffinized, and then the tumor tissue was scraped into a 1.5 mL eppendorf tube containing 50
Primers for HPV testing.
Name | Sequence 5′ to 3′ |
---|---|
GAPDH F | GCTCATTTGCAGGGGGGAGCC |
GAPDH R | CTGATGATCTTGAGGCTGTTG |
HPV 16 F | TTGCAGATCATCAAGAACACGTAGA |
HPV 16 R | GTAGAGATCAGTTGTCTCTGGTTGC |
HPV 18 F | CAACCGAGCACGACAGGAACG |
HPV 18 R | TAGAAGGTCAACCGGAATTTTCAT |
F: forward, R: reverse.
Exome libraries were created at The Centre for Advanced Genomics (Toronto, Canada) according to the manufacturer’s standard protocol for SOLiD library preparation (Applied Biosystems, Carlsbad, CA, USA). Three
Samples were processed as matched sets through the Genome Analysis ToolKit (GATK) v1.3-16 pipeline [
To be considered for further downstream analysis, a tumor variant had to have at least 8x coverage within the target regions 37,038,261 sites (71.86%) for the HPV-positive tumor and 39,150,091 sites (75.96%) for the HPV-negative tumor that met this criterion. In addition to coverage, the following requirements had to be identified by the VariantFiltration walker: variant quality equal to or greater than 30, variant confidence/quality by depth (QD) equal to or greater than 2.0, MQ0 < 4 and MQ0/(1.0 * DP)) < 0.1, where MQ0 is the total mapping quality zero reads and DP is the unfiltered read depth.
A reference variant required a minimum read depth of 8x within the target region for further consideration (38,673,520 sites (75.03%) and 38,058,450 sites (73.84%) for HPV-positive and HPV-negative tumors, resp.). This presented 36,020,799 and 37,049,778 comparable sites in the HPV-positive and HPV-negative tumors. Using in-house custom Perl code, somatic variants within the targeted regions were identified. To be classified as a somatic variant the following conditions had to be met:
Genomic DNA was extracted from matching tumor and blood samples from two head and neck cancer patients: patient 1 was a 49-year-old nonsmoking and nondrinking male, and patient 2 was an 81-year-old female smoker. Patient demographics, treatment details, and histopathologic parameters are outlined in Table
Patient demographics.
Patient 1 | Patient 2 | |
---|---|---|
HPV positive | HPV negative | |
Age | 49 | 81 |
Gender | Male | Female |
Primary site | Tonsil | Oral tongue |
Stage | T2N0 | T2N0 |
Smoking | Nonsmoker | 50 pack years |
Alcohol | Nondrinker | Rare |
Differentiation | Moderate | Moderate to poorly |
Adverse features | Perineural invasion | Perineural invasion |
p16 | Positive | Negative |
HPV | Positive | Negative |
Treatment | TORS + ND | Transoral resection, ND, RFFF |
HPV: human papillomavirus, TORS: transoral robotic surgery, ND: neck dissection, and RFFF: radial forearm free flap.
Tumors from two patients were sectioned. Slices were stained with ((a) and (b)) H&E, ((c) and (d)) p16, or ((e) and (f)) HPV
We employed primers designed specifically against unique portions of the E6-E7 region of HPV type 16 and type 18 to confirm the HPV status of the patients in this study. The GAPDH control was amplified from both patients; as expected, only patient 1 was HPV type 16 positive (Figure
PCR confirmation of the presence of HPV type 16 DNA in patient 1 and the absence of HPV type 16 sequences in patient 2.
The exomes from tumor tissue and matched blood samples from each patient were sequenced. For each tumor or blood sample, approximately 1.2 billion bases were sequenced, 86% of which were specific for exome sequences. The mean coverage of the exome targets was 28.1-fold, with 91.6% of the targets being sequenced at least once and 67.4% sequenced at least ten times. The exome capture and sequencing results were within the normal range of performance specified by the manufacturer and are comparable with published results [
We compared the sequencing results of each patient’s tumor to their matched blood samples in order to eliminate background germline variations and to focus on somatic alterations unique to the tumor genome. Although the exome capture is designed to target coding regions, some intergenic and intron regions adjacent exons are captured in the process. A complete listing of the identified variants in coding and noncoding regions for the HPV-positive and HPV-negative tumors is reported in Tables S1 and S2, respectively (see Supplementary Material available online at doi: 10.5402/2012/809370). Only the variants that occurred within exons are listed in Tables
Coding mutations in the HPV-positive tumor.
Chr | Position | Reference allele | Tumor allele | Zygosity | dbSNP ID | Region | Type | Gene | Transcript name | Exon | CDS position | Protein change | Stansky* | Agrawal** |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
19 | 15789140 | A | G | Homo | rs609290 | Exonic | Nonsynonymous | CYP4F12 | NM_023944 | 3 | c.A268G | p.I90V | Yes | |
10 | 88946876 | G | A | Hetero | Exonic | Nonsynonymous | FAM35A | NM_019054 | 8 | c.G2227A | p.D743N | |||
3 | 51930850 | T | C | Homo | rs57859638 | Exonic | Nonsynonymous | IQCF1 | NM_152397 | 3 | c.A169G | p.K57E | ||
7 | 20180717 | C | G | Homo | rs3735615 | Exonic | Nonsynonymous | MACC1 | NM_182762 | 7 | c.G2411C | p.R804T | Yes | |
14 | 64882380 | A | G | Hetero | rs1950902 | Exonic | Nonsynonymous | MTHFD1 | NM_005956 | 6 | c.A401G | p.K134R | ||
7 | 100634194 | C | G | Hetero | Exonic | Nonsynonymous | MUC12 | NM_001164462 | 2 | c.C350G | p.A117G | |||
19 | 9006667 | A | G | Homo | rs75101943 | Exonic | Nonsynonymous | MUC16 | NM_024690 | 44 | c.T39581C | p.I13194T | Yes | |
19 | 9074122 | T | G | Homo | Exonic | Nonsynonymous | MUC16 | NM_024690 | 3 | c.A13324C | p.T4442P | Yes | ||
3 | 195517753 | C | T | Hetero | Exonic | Nonsynonymous | MUC4 | NM_018406 | 2 | c.G698A | p.G233E | Yes | ||
11 | 1017381 | G | C | Hetero | rs34912894 | Exonic | Nonsynonymous | MUC6 | NM_005961 | 61 | c.C5420G | p.T1807S | Yes | |
19 | 50865535 | A | G | Homo | rs676314 | Exonic | Nonsynonymous | NAPSA | NM_004851 | 2 | c.T119C | p.I40T | ||
4 | 170345835 | G | C | Homo | Exonic | Nonsynonymous | NEK1 | NM_001199397 | 31 | c.C3091G | p.Q1031E | |||
17 | 3195485 | C | T | Hetero | Exonic | Nonsynonymous | OR3A1 | NM_002550 | 1 | c.G392A | p.R131Q | |||
3 | 98073075 | A | G | Hetero | Exonic | Nonsynonymous | OR5K4 | NM_001005517 | 1 | c.A378G | p.I126M | Yes | ||
5 | 140590766 | A | G | Homo | rs2910006 | Exonic | Nonsynonymous | PCDHB12 | NM_018932 | 1 | c.A2287G | p.K763E | ||
12 | 27787878 | G | A | Hetero | Exonic | Nonsynonymous | PPFIBP1 | NM_001198916 | 4 | c.G100A | p.D34N | |||
15 | 43827261 | G | C | Hetero | Exonic | Nonsynonymous | PPIP5K1 | NM_001190214 | 30 | c.C3832G | p.H1278D | |||
1 | 12853378 | T | G | Hetero | rs112330886 | Exonic | Nonsynonymous | PRAMEF1 | NM_023013 | 2 | c.T2G | p.M1R | Yes | |
X | 135956575 | G | A | Hetero | rs78646793 | Exonic | Nonsynonymous | RBMX | NM_002139 | 9 | c.C902T | p.P301L | ||
6 | 33272855 | G | C | Homo | rs2071888 | Exonic | Nonsynonymous | TAPBP | NM_172208 | 4 | c.C779G | p.T260R | ||
12 | 11183046 | C | T | Hetero | Exonic | Nonsynonymous | TAS2R31 | NM_176885 | 1 | c.G889A | p.V297M | |||
12 | 11213969 | A | G | Hetero | rs2599402 | Exonic | Nonsynonymous | TAS2R46 | NM_176887 | 1 | c.T925C | p.S309P | Yes | |
3 | 100084425 | T | G | Homo | Exonic | Nonsynonymous | TOMM70A | NM_014820 | 12 | c.A1810C | p.K604Q | Yes | ||
9 | 135277007 | C | T | Homo | rs3739916 | Exonic | Nonsynonymous | TTF1 | NM_007344 | 2 | c.G1202A | p.R401Q | Yes | |
19 | 38378659 | A | T | Homo | Exonic | Nonsynonymous | WDR87 | NM_031951 | 6 | c.T5535A | p.N1845K | |||
9 | 74975645 | C | G | Hetero | Exonic | Nonsynonymous | ZFAND5 | NM_001102421 | 2 | c.G50C | p.G17A | |||
12 | 133732818 | C | T | Hetero | Exonic | Nonsynonymous | ZNF10 | NM_015394 | 5 | c.C986T | p.S329F | |||
19 | 44933706 | C | T | Hetero | rs57014690 | Exonic | Nonsynonymous | ZNF229 | NM_014518 | 6 | c.G1250A | p.S417N | Yes | |
19 | 57089050 | C | T | Hetero | rs4801177 | Exonic | Nonsynonymous | ZNF470 | NM_001001668 | 6 | c.C1253T | p.T418I | Yes | |
19 | 52618497 | A | T | Hetero | Exonic | Nonsynonymous | ZNF616 | NM_178523 | 4 | c.T1920A | p.N640K | Yes | ||
2 | 71654175 | G | A | Homo | rs1804020 | Exonic | Nonsynonymous | ZNF638 | NM_001252612 | 24 | c.G5176A | p.V1726M | ||
7 | 57528923 | G | C | Hetero | Exonic | Nonsynonymous | ZNF716 | NM_001159279 | 4 | c.G756C | p.W252C |
Chr: chromosome, *mutations present in Stransky et al., Science 2011 [
Coding mutations in the HPV-negative tumor.
Chr | Position | Reference allele | Tumor allele | Zygosity | dbSNP ID | Region | Type | Gene | Transcript name | Exon | CDS position | Protein change | Stansky* | Agrawal** |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
2 | 73679256 | C | G | Homo | Exonic | Nonsynonymous | ALMS1 | NM_015120 | 8 | c.C5599G | p.L1867V | Yes | ||
10 | 37451586 | G | A | Hetero | rs12766884 | Exonic | Nonsynonymous | ANKRD30A | NM_052997 | 16 | c.G1742A | p.G581E | Yes | |
9 | 33385733 | C | T | Hetero | Exonic | Nonsynonymous | AQP7 | NM_001170 | 7 | c.G657A | p.M219I | |||
17 | 42271663 | G | C | Homo | Exonic | Nonsynonymous | ATXN7L3 | NM_001098833 | 12 | c.C1012G | p.P338A | |||
6 | 136599913 | A | T | Hetero | Exonic | Nonsynonymous | BCLAF1 | NM_001077441 | 4 | c.T106A | p.S36T | |||
1 | 26646726 | A | G | Hetero | rs1071849 | Exonic | Nonsynonymous | CD52 | NM_001803 | 2 | c.A119G | p.N40S | ||
1 | 26646730 | A | G | Homo | rs17645 | Exonic | Nonsynonymous | CD52 | NM_001803 | 2 | c.A123G | p.I41M | ||
19 | 42213948 | C | G | Hetero | Exonic | Nonsynonymous | CEACAM5 | NM_004363 | 2 | c.C414G | p.F138L | |||
12 | 31242362 | A | G | Hetero | rs3950588 | Exonic | Nonsynonymous | DDX11 | NM_030653 | 8 | c.A818G | p.K273R | Yes | |
15 | 83657820 | G | C | Hetero | Exonic | Stoploss | FAM103A1 | NM_031452 | 3 | c.G50C | p.X17S | |||
6 | 76023130 | T | G | Homo | Exonic | Nonsynonymous | FILIP1 | NM_015687 | 5 | c.A2418C | p.Q806H, | Yes | ||
1 | 152191709 | C | G | Hetero | rs6662450 | Exonic | Nonsynonymous | HRNR | NM_001009931 | 3 | c.G2396C | p.S799T | Yes | |
9 | 21202136 | A | G | Hetero | rs145794215 | Exonic | Nonsynonymous | IFNA7 | NM_021057 | 1 | c.T29C | p.V10A | ||
7 | 100635103 | A | C | Hetero | Exonic | Nonsynonymous | MUC12 | NM_001164462 | 2 | c.A1259C | p.E420A | |||
17 | 10404435 | T | G | Hetero | Exonic | Nonsynonymous | MYH1 | NM_005963 | 27 | c.A3730C | p.K1244Q | Yes | Yes | |
18 | 47364086 | C | T | Hetero | Exonic | Nonsynonymous | MYO5B | NM_001080467 | 37 | c.G4939A | p.D1647N | Yes | ||
12 | 57106659 | C | G | Hetero | Exonic | Nonsynonymous | NACA | NM_001113203 | 10 | c.G2674C | p.E892Q | Yes | ||
1 | 21795333 | C | G | Hetero | Exonic | Nonsynonymous | NBPF3 | NM_032264 | 3 | c.C286G | p.Q96E | Yes | Yes | |
10 | 115370274 | T | C | Homo | rs10749138 | Exonic | Nonsynonymous | NRAP | NM_006175 | 30 | c.A3442G | p.I1148V | Yes | Yes |
11 | 48346916 | G | C | Homo | rs77069283 | Exonic | Nonsynonymous | OR4C3 | NM_001004702 | 1 | c.G424C | p.V142L | Yes | |
11 | 4608046 | T | A | Hetero | Exonic | Nonsynonymous | OR52I2 | NM_001005170 | 1 | c.T4A | p.C2S | |||
11 | 56128081 | A | G | Hetero | rs10896290 | Exonic | Nonsynonymous | OR8J1 | NM_001005205 | 1 | c.A359G | p.Y120C | Yes | |
11 | 56143823 | G | A | Homo | rs77614949 | Exonic | Nonsynonymous | OR8U1, OR8U8 | NM_001005204 | 1 | c.G724A | p.G242S | ||
X | 82764042 | G | C | Hetero | rs5921979 | Exonic | Nonsynonymous | POU3F4 | NM_000307 | 1 | c.G710C | p.G237A | Yes | |
19 | 43709656 | C | G | Homo | rs11883278 | Exonic | Nonsynonymous | PSG4 | NM_213633 | 1 | c.G33C | p.Q11H | Yes | |
14 | 21511497 | C | T | Homo | rs1243469 | Exonic | Nonsynonymous | RNASE7 | NM_032572 | 2 | c.C346T | p.H116Y | ||
1 | 153004853 | C | T | Homo | rs3795382 | Exonic | Nonsynonymous | SPRR1B | NM_003125 | 2 | c.C32T | p.T11I | ||
6 | 33410273 | T | A | Homo | Splicing | NA | SYNGAP1 | NM_006772 | 14 | c.2336+2T>A | ||||
12 | 11174327 | C | T | Hetero | rs72475481 | Exonic | Nonsynonymous | TAS2R19 | NM_176888 | 1 | c.G844A | p.G282R | ||
12 | 11183676 | C | T | Hetero | rs73049072 | Exonic | Nonsynonymous | TAS2R31 | NM_176885 | 1 | c.G259A | p.V87I | ||
7 | 35244086 | A | T | Hetero | Exonic | Nonsynonymous | TBX20 | NM_001077653 | 7 | c.T999A | p.N333K | |||
21 | 10910347 | A | G | Hetero | rs150482 | Exonic | Nonsynonymous | TPTE | NM_199261 | 22 | c.T1409C | p.L470P | ||
7 | 99669149 | C | T | Hetero | Exonic | Nonsynonymous | ZNF3 | NM_032924 | 6 | c.G958A | p.A320T | |||
19 | 57839150 | A | G | Homo | rs8100491 | Exonic | Nonsynonymous | ZNF543 | NM_213598 | 4 | c.A320G | p.Q107R | Yes | |
12 | 124497119 | T | A | Hetero | Exonic | Nonsynonymous | ZNF664 | NM_001204298 | 5 | c.T428A | p.F143Y | |||
19 | 12501852 | C | T | Hetero | Exonic | Nonsynonymous | ZNF799 | NM_001080821 | 4 | c.G1360A | p.G454R | Yes |
Chr: chromosome, *mutations present in Stransky et al., Science 2011 [
No mutations were noted in TP53, CDKN2A (p16), or the NOTCH receptors in either tumor. However, multiple mutations were noted in zinc finger genes (ZNF3, 10, 229, 470, 543, 616, 664, 638, 716, and 799) and mucin genes (MUC4, 6, 12, and 16). Mutations were noted in MUC12 in both tumors.
Patient characteristics, PCR analysis,
Detection of HPV 16 sequences with the exome captures of the four patient samples. Short read sequences generated from the exome sequencing data denoted by the small bars were found exclusively in the DNA from the HPV-positive tumor but not in the matched blood from the same patient or the HPV-negative patient’s tumor or blood with the exception of the nonspecific poly-A signal.
HPV-positive head and neck squamous cell carcinoma (HNSCC) has been described as molecularly distinct from traditional head and neck cancer [
Only a single genetic mutation (Muc12) was shared by both HPV-positive and HPV-negative tumor samples. The cell surface associated Muc12 was the only mucin identified in the HPV-negative tumor. In contrast, the HPV-positive tumor had five mutations in four different mucin genes, including the secreted Muc6, and the transmembrane bound Muc4, Muc12 and Muc16. Stransky et al. reported mutations in all the above mucins except for Muc12 [
We also found multiple mutations in the zinc finger (ZNF) family genes in both tumor types. The ZNF family represents a large group of molecules which are involved in various aspects of transcriptional regulation [
We confirmed that the sequence from the human pathogen HPV type 16 was identified within exome sequence of a HNSCC tumor. In order for HPV to be oncogenic, the viral E2 protein, which represses the expression of E6 and E7, must be lost [
This study represents a pilot effort to gain experience with this exciting new technology, which was instructive as our group moves forward with large-scale projects. In addition to the small sample size, the quality of data generated limited by the ABI SOLiD platform with an average 30-fold coverage with 50 base pair paired-end reads yielded only 10-fold coverage over approximately two-thirds of the coding sequence. Thus, approximately a third of the exome was not adequately evaluated and important mutations could have been missed. We have recently completed characterizing a panel of head and neck cancer cell lines with 100-fold coverage with 100 base pair paired-end reads, and the results were vastly superior [
It should be noted that tremendous insights can be gained by exome sequencing; however, whole genome sequencing offers the advantage to identify other genetic changes that can lead to tumorigenesis including copy number variation and translocations, in addition to point mutations, insertions, and deletions. Alterations in noncoding regions that may be important, such as promoters and miRNAs, would also be identified. The study by Stransky et al. reported whole genome sequencing in two patients and revealed markedly more translocations in the HPV-negative versus the HPV-positive tumors [
Whole exome sequencing of head and neck cancers can provide important insights into the molecular biology of the disease. HPV-positive and negative head and neck cancers are molecularly distinct, and HPV-negative cancers tend to harbor more mutations. Multiple, integrated HPV 16 sequences were identified in the exome targets from the HPV positive patient. These matches were restricted to the HPV-positive patient’s tumor profile providing evidence of the utility of screening exome sequences against pathogen databases.
None of the authors have financial relationships with any of the commercial identities mentioned in this paper.
Anthony C. Nichols, Michelle Chan-Seng-Yue, John Yoo, Paul Boutros, and John W. Barrett all contributed equally to this work.
Exome sequencing was performed by The Centre for Advanced Genomics (TCAG) at the University of Toronto. Funding was provided through the translational Head and Neck Cancer Program fund, Western University (ACN), and the support of the Ontario Institute for Cancer Research (PCB) by the Government of Ontario are gratefully acknowleged.