A compost of vegetable waste and
During the last decades, various studies in Tunisia investigated the effects of organic composts as nutrient-rich amendments to correct mineral deficiencies of soils in a semiarid climate [
It is well known that compost offers a disease control alternative to fungicides [
Soil sterilization destroys the most heat-labile part of compost microbial communities and temporarily reduces microbial activity [
Tomato plants treated by
Fusarium crown and root rot is an important soil-borne disease, with the potential to limit productivity in glasshouse and field tomato crops. The causal agent,
Increased early injury to the roots and collar of tomato plants caused by
Fungicides are of little use on most Fusarium diseases [
Biological control of Fusarium wilts, in the form of natural microbial populations in soils, has been recognized for over 70 years [
The overuse of chemical fertilisers and excessive disturbance often leads to soils low in soil organic matter (SOM). The levels of SOM in Tunisian soils have been declining sharply in the last decades, which increased the soil degradation. Municipal solid compost could bring some pollutants like heavy metals into soil [
The agronomic reuse of
It is estimated that the quantity of composted vegetable residues and market wastes produced by Tunis City is greater than 17 t/d, which is a sizable volume of substrate for a biological treatment [
In this project, we studied the biofungicide effect of VPC against Forl. We analysed the direct effect of VPC on mycelial growth of Forl
The initial compost material consisted of 70% of vegetable residues (VR), and 30% of
The windrow was sampled during each turning. Four samples were taken at the start of the composting process and samples were collected every 5 days for 150 days. Samples of 5 kg taken from various composts were subdivided into three subsamples introduced by [
Each fraction obtained was characterised by measuring the following parameters: CO2 released, pH, Kjeldahl N and inorganic N concentrations. Oxidable-C was determined by dichromate oxidation according to the procedure described in norm NF T 90–101 (October, 1998). Total organic N was measured using the Kjeldahl procedure and the inorganic N content was determined in a 1 mol/L KCl extract (1 : 10, W/V) by steam distillation in the presence of MgO (NH4+-N) or MgO + Devarda’s alloy (NH4 +-N + NO2-N + NO3 -N) [
The CO2 evolution was measured according to the incubation method of [
Germination tests were performed with wheat (Karim, var) provided by the gene bank of National Agronomic Institute Tunisia. Eight seeds, three replicates for each sample of the compost, were left to germinate in the water extract of the compost at 25°C for 72 h. The germination index (GI) was computed by the formula [
where,
VPC samples used in studies on biocontrol of
To study the activity of VPC against mycelial growth of Forl, the potato dextrose agar PDA medium was autoclaved for 15 min at 100 kPa. Then, different concentrations (0.5, 1, 2, 4, 6, 8, 10, 15, and 20%) of VPC (sterilized or not) were incorporated in the potato dextrose agar (PDA) medium. VPC was sterilized during 1 hour at 100 kPa.
The production of Antifungal Volatile (AFV) compounds, by compost were assayed by the sealed plate method as described by [
The cyanide production was detected using the assay method of [
For detection of antibiotic production, suspensions of VPC were incubated for 60 h in an incubator shaker maintained at 30°C and 170 rpm. The compost extract was centrifuged at 10000
For isolation of bacterial strains, 10 g of VPC was suspended in 90 mL of sterile distilled water and shaken for 10 min at 250 rpm. One millilitre of this suspension was used to prepare serial 10-fold dilutions in 0.9% NaCl. Aliquots (100
Antagonism tests were performed on Potato Dextrose Agar (PDA) in 10 cm Petri plates using a dual culture technique [
Bacterial isolates were streaked on TSB medium and then incubated at 30°C for 24 h. A loop of inoculum from a 12 h culture was introduced into 100 mL of the production medium as per [
The identification of bacterial strains was achieved by sequencing the 16S rRNA gene (rrs). Amplification was carried out by PCR with primers F667-pA-rrs AGAGTTTGATCCTGGCTCAG and F668-pH-rrs AAGGAGGTGATCCAGCCGCA designed by [
An agricultural Soil Vertic Xero Fluvent (clay: 27%, silt: 62%, sand: 11%, pH[water]: 7, C (0.87%), N: 0.095% C/N: 9.15). was obtained from a field located in the region of Mornag (southwest of Tunis). The soil was moistened with distilled water to 60% of its water-holding capacity and autoclaved for 1 h at 121°C twice, on 2 successive days. The soil was maintained at 60% of its water-holding capacity for a week under sterile conditions. The soil was again autoclaved twice for 20 min at 121°C. After cooling, it was placed in plastic pots (dimensions: 10 cm × 10 cm × 2.5 cm).
This part of experience is divided in two parts: the first one consists of testing the effect of VPC on the fusariose development. The second part concerns the effect of bacteria isolated from VPC on the studied disease. To study the activity of VPC against the development of mycelial of Forl, under pot experience. Different concentrations (0, 10, and 20%) of VPC (sterilized or not) were incorporated and homogenised in the soil. VPC was sterilized during 1 hour at 100 kPa.
Tomato seeds (
This part of experience is divided in two parts, the first one consists of testing the effect of VPC on the fusariose development. The second part concerns the effect of bacteria isolated from VPC on the studied disease. To study the VPC effect against the development of mycelial of Forl, under pot experience. Different concentrations (0, 10, and 20%) of VPC (sterilized or not) were incorporated and homogenised in the soil. VPC was sterilized during 1 hour at 100 kPa.
The second part of the pot experience was undertaken in the same pot condition as in the first experience at the difference the seeds were inoculated with bacteria isolated from VPC by using a liquid suspension (
Disease incidence was assessed at 6 weeks by counting number of healthy plants.
The carbon-to-nitrogen ratio ranged from 30 at the beginning of composting and decreased notably through the process to reach values around 12 (Figure
Trends of biochemical and microbiological parameters during composting cycle of mixed vegetable waste (70%) and dead
The incorporation of VPC in the culture medium revealed potent antifungal activity against Forl and complete inhibition of mycelium growth at all the tested concentrations of unsterilized compost extract (Figure
Effect of VPC extract (a) and volatiles produced by VPC extract (b) against Forl on mycelial growth of Forl.
Different rates of VPC produced AFV’s able to inhibit mycelial growth (Figure
Effect of doses compost in volatiles, antibiotic, cyanide production, and growth of fungi in sterilized extract compost and non sterilized compost.
Compost extract (%) | ||||||||||
0 | 0.5 | 1 | 2 | 4 | 6 | 8 | 10 | 15 | 20 | |
Volatiles | − | − | − | − | + | + | + | + | + | + |
Cyanide | − | − | − | − | + | + | + | + | + | + |
Antibiotic | − | + | + | + | + | + | + | + | + | + |
Growth of fungi in SEC | − | + | + | + | + | + | + | + | + | + |
Growth of fungi in NSEC | − | − | − | − | − | − | − | − | − | − |
SEC: sterilized extract compost; NSEC: nonsterilized extract compost (+): positive production, (−): negative production. Cyanide production was detected as described by [
Nine bacterial strains were isolated from VPC that exhibited antifungal activity towards Forl in agar well-diffusion assays and in dual culture (Table
Effect of Bacillus isolates obtained from the compost materials on
Isolates | Identify of the selected isolates | Dual culture assay | |||
% mycelial inhibition | % fungal inhibition by volatiles | Antibiotic production | Cyanide production | ||
B6 | + | − | |||
B10 | + | + | |||
B12 | + | − | |||
B17 | − | + | |||
BuC16 | − | − | |||
PPS7 | + | + | |||
BS1 | + | − | |||
BS2 | + | − | |||
BS3 | + | − |
Percent growth inhibition was determined after days of incubation using [
VPC application on
Newman’s keuls test differences were assessed at
Inoculation of seeds with the nine bacterial isolates significantly increased the percentage of healthy plants (Table
Dendogram grouping of 9 strains isolated from VPC, based on healthy plant percentage. Experience realized
Strain
The VPC can be an interesting biodegradable organic material for compost production. Since both vegetable waste and
The vast majority of studies on compost suppressiveness demonstrate a relationship between disease suppression and microbial activity. Suppression of Fusarium wilt of tomato using VPC could have been caused by compounds such as cyanide, as well as to some of VPC’s indigenous bacterial strains that act as antagonists. After sterilization, VPC lost the ability to suppress
The complete growth inhibition of Forl demonstrated that
Cyanide produced by antagonistic bacteria results in a natural mechanism of plant defence. The forms of cyanide most often discussed from a monitoring viewpoint were free cyanide, weak acid dissolvable (WAD) cyanide, and total free cyanide consisting of HCN and CN. We noted that WAD cyanides were the form required for plant defence. Some authors established that when compost was added to soil, it enhanced the growth of fungi compared to a control (soil not amended with compost) and the WAD cyanide quantities were concentrated in plant shoots [
The significant reduction of damping-off incidence on tomato plants using the VPC amendment may be attributed to the effect of polyphenols and other chemical compounds. Several researchers have demonstrated that micro-organisms isolated from compost are able to suppress plant disease. Some phytopathogenic bacteria like
It is possible that indigenous bacterial strains were also involved in the inhibition of fungal growth. Our study showed that some VPC bacteria play a role against Forl. [
The reduction of the Fusarium growth
The inhibition effect of sterilized VPC at high rates may be due to the chelating of nutrients (from the environmental medium) necessary for fungal growth. High nitrogen content could also inhibit the fungal growth. Indeed, Forl was found to be more sensitive to unsterilized VPC. This result seems to be evident due to the antagonistic bacterial effect. In the present study
Vegetable residues
Vegetable
Municipal solid waste
Control of crown and root rot
Agar well diffusion method
Potato dextrose agar
Weak acid dissolvable
Antifungal volatile
Tons per day
Carbon dioxide.
The authors are grateful to Asma Riahi and Ahmed El Aamri from National Centre of Scientific and Technical Documentation (CNUDST) for the generous help and assistance in web data. They also grateful R. J. Kremer and A. Kennedy for their assistance in the preparation of the paper. The present study is a part of the 1999–2002 research program “Municipal solid waste treatment and compost agriculture application” which is supported jointly by the Tunisian State Secretariat of Scientific Research and Technology.