Interferons, as the first line of defense against the viral infection, play an important role in innate immune responses. Type III interferon (IFN-
Interferons (IFNs), a broad spectrum antiviral agent, act as the first line of defense against viral infection and have an important role in innate immune responses [
The genomic structure of IFN-
As known, in mammals, the antiviral activity of IFN-
Thirteen IFNLR1 genes from different bird species, two IFNLR1 genes from reptiles, six IFNLR1 genes from mammals, and one IFNLR1 gene from fish species were chosen as the reference sequences from NCBI GenBank database (
The healthy gooses (the Chinese goose,
The animal studies were approved by the Institutional Animal Care and Use Committee of Sichuan Agricultural University and followed National Institutes of Health guidelines for the performance of animal experiments.
Eleven kinds of fresh goose tissues, including small intestine (SI), lung (Lu), spleen (SP), liver (Li), kidney (K), cecum (Ce), cecal tonsil (CT), bursa of fabricius (BF), harderian gland (HG), proventriculus (Pr), and thymus (T) from three individual gooses at different age groups, were collected, respectively. The time points for sampling were one-day (1D) group, one-week (1W) group, two-week (2W) group, four-week (4W) group, and adult gooses (beyond one year) group.
Total RNA was extracted from fresh goose’s small intestine and cecum tissue, using the RNA extract reagent TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. The cDNA was synthesised using HiScript 1st Strand cDNA Synthesis Kit (Vazyme), according to the manufacturer’s instructions. And cDNA templates of all different samples were stored at −70°C.
The degenerate primers of goIFNLR1 were designed via multiple sequence alignments with the
The list of primers.
Primer name | Sequence 5′-3′ | Application |
---|---|---|
Oligo(dT)18 | TTTTTTTTTTTTTTTTTT | Reverse transcription |
IFNLR1-1F | ACATGG(A/G)C(T/G)CC(A/G)GGAGAAGG | Degenerate PCR |
IFNLR1-1R | TCTTGTCTTCAGA(T/C)CC(G/A/T/C)GC | Degenerate PCR |
IFNLR1-5G0 | AGGCGGCATTCAC | 5RACE PCR |
IFNLR1-5GSP1 | AGCCAGTTCCACATCCAAAT | 5RACE PCR |
IFNLR1-5GSP2 | TCCTGGCTTTCATACCTCAC | 5RACE PCR |
5RACE-AAP | GGCCACGCGTCGACTACGGGIIGGGIIGG |
5RACE PCR |
5RACE-AUAP | GGCCACGCGTCGACTAGTAC | 5RACE PCR |
IFNLR1-3GSP1 | CTATTTGGATGTGGAACTGGCTC | 3RACE PCR |
IFNLR1-3GSP2 | CCTGGATGTATGACTTGAACC | 3RACE PCR |
3RACE-AP | GGCCACGCGTCGACTAGTACT(17) | 3RACE PCR |
3RACE-AUAP | GGCCACGCGTCGACTAGTAC | 3RACE PCR |
IFNLR1-2F | ATGCTCCTCCATAAGTCG | Full-length amplification |
IFNLR1-2R | GCTGTGACTTCTCCCTGA | Full-length amplification |
IFNLR1-3F | TCTGAAGACAAGAAGCAAT | qRT-PCR |
IFNLR1-3R | GCACACTGGTTGGGAGAAT | qRT-PCR |
CCGTGACATCAAGGAGAA | qRT-PCR | |
GAAGGATGGCTGGAAGAG | qRT-PCR |
Taxonomy of species, accession numbers of IFNLR1 sequences, and the amino acid similarity and identity with goIFNLR1 proteins were analyzed using BLASTP with a BLOSUM62 scoring matrix. Identity means complete identical amino acid pairs.
Taxonomy | Species |
|
Accession number |
---|---|---|---|
Identity (%) | |||
Birds |
|
90 | XP_005028203.1 |
|
73 | AHF20241.1 | |
|
63 | XP_005058494.1 | |
|
58 | XP_005529866.1 | |
|
75 | XP_005433108.1 | |
|
74 | XP_005234192.1 | |
|
70 | XP_005142513.1 | |
|
68 | XP_005513512.1 | |
|
61 | XP_008633390.1 | |
|
62 | XP_009096915.1 | |
|
58 | XP_005427215.1 | |
|
57 | XP_005494786.1 | |
|
80 | XP_009274512.1 | |
|
|||
Reptiles |
|
47 | XP_006019447.1 |
|
48 | XP_005302269.1 | |
|
|||
Mammalia |
|
36 | NP_777276.3 |
|
32 | XP_002716066.1 | |
|
35 | XP_004266740.1 | |
|
37 | XP_005607410.1 | |
|
34 | NP_734464.1 | |
|
35 | XP_003891375.2 | |
|
|||
Fish |
|
26 | NP_001184131.1 |
Bio-Rad CFX 96 Real-Time qPCR instrument was used for qRT-PCR, which was employed on total RNAs for detecting the tissue distribution of goIFNLR1 with primers of IFNLR1-3F and IFNLR1-3R (All the primers were listed in Table
The potential ORF of goIFNLR1 was analyzed by using open reading frames (ORF) finder program (
Geese are domesticated from
The nucleotides and deduced amino acid sequences of goIFNLR1 gene. The numbers of nucleotides were shown on the left and the numbers of amino acids were bold also on the left. The initiation codon and stop codon were displayed in red font, the predicted signal peptide of these genes was underlined, and the predicted transmembrane domain was shadowed.
Predicted transmembrane region and signal peptide for goIFNLR1. (a) The signal peptide of goIFNLR1 was predicted by Signal 4.1 Server. C, S, and Y scores indicate cleavage sites, signal peptide, and combined cleavage site predictions, respectively. (b) The transmembrane region of goIFNLR1 was predicted by TMHMM 2.0 server, 23 aa were included in this region.
The cDNA sequence of goIFNLR1 was highly conserved with that of other birds; the amino acid identity showed more than 90% with
The comparison of goIFNLR1 amino acid sequences with other reported IFNLR1 sequences (
Similarity of IFNLR1 sequences between goose and other birds analyzed by MegAlign. The percentage of similarity was showed in upper triangle and the percentage of divergence was showed in lower triangle.
Species | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
(1) |
|
89.5 | 67.7 | 60.1 | 73.8 | 73.6 | 60.3 | 71.6 | 58.1 | 67.3 | 56.7 | 58.6 | 57.3 |
(2) |
11.4 |
|
68.5 | 61.8 | 77.1 | 76.9 | 62.2 | 73.0 | 59.8 | 70.1 | 58.9 | 58.7 | 58.9 |
(3) |
42.1 | 40.9 |
|
63.1 | 77.4 | 77.2 | 60.8 | 63.6 | 61.0 | 70.5 | 60.6 | 61.6 | 60.2 |
(4) |
56.3 | 52.9 | 50.4 |
|
67.9 | 67.9 | 81.8 | 59.0 | 85.0 | 65.0 | 83.4 | 83.0 | 81.9 |
(5) |
32.3 | 27.4 | 26.9 | 41.7 |
|
99.8 | 66.0 | 72.1 | 65.0 | 76.1 | 64.5 | 64.4 | 63.4 |
(6) |
32.6 | 27.7 | 27.2 | 41.7 | 0.2 |
|
66.0 | 71.9 | 65.0 | 75.9 | 64.5 | 64.4 | 63.4 |
(7) |
56.0 | 52.3 | 54.9 | 20.9 | 45.1 | 45.1 |
|
57.1 | 84.6 | 63.4 | 81.4 | 81.3 | 82.6 |
(8) |
35.8 | 33.4 | 49.6 | 58.6 | 34.9 | 35.2 | 62.6 |
|
57.3 | 65.5 | 55.3 | 56.1 | 55.9 |
(9) |
60.5 | 56.9 | 54.6 | 16.7 | 46.9 | 46.9 | 17.3 | 62.6 |
|
62.4 | 83.1 | 90.3 | 92.1 |
(10) |
2.8 | 38.0 | 37.5 | 46.8 | 28.9 | 29.1 | 49.9 | 46.0 | 51.8 |
|
61.7 | 61.9 | 60.7 |
(11) |
63.5 | 58.9 | 55.3 | 18.8 | 47.8 | 47.8 | 21.5 | 66.8 | 19.1 | 53.2 |
|
80.9 | 80.9 |
(12) |
59.5 | 59.2 | 53.4 | 19.4 | 48.0 | 48.0 | 21.6 | 65.0 | 10.4 | 52.7 | 22.1 |
|
89.0 |
(13) |
62.3 | 58.8 | 56.3 | 20.8 | 49.8 | 49.8 | 19.9 | 65.3 | 8.4 | 55.2 | 22.1 | 11.9 |
|
Multiple alignments of amino acid sequences of
A phylogenetic tree of the amino acid sequences of IFNLR1 from different species. The putative gene-tree was built using the Neighbor-Joining method based on the alignment of IFNLR1 amino acid sequences. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test was shown next to the branches. Evolutionary analyses were conducted in MEGA 6.0. The sequences used were listed in Table
To examine the tissue distribution of goose IFNLR1, Oligo(dT)18 was used as primer and the eleven tissues were used as templates to do reverse transcription PCR, the mRNA expression level of goIFNLR1 was determined by qRT-PCR. As shown in Figure
The qRT-PCR detection of IFNLR1 mRNA expression in different tissues from 3 healthy individuals. goIFNLR1 transcription was evaluated in small intestine (SI), cecum (Ce), liver (Li), lung (Lu), proventriculus (Pr), kidney (K), spleen (SP), thymus (T), bursa of fabricius (BF), harderian gland (HG), and cecal tonsil (CT). The error bars represented standard deviation. The goIFNLR1 mRNA was measured in qRT-PCR and normalized against the housekeeping gene (goose
Considering the ubiquitous distribution of goIFNLR1 was observed, we are wondering if the expression of goIFNLR1 was changed in an age-dependent way in the epithelial related tissues. Goose primary epithelial related tissues derived from small intestine, kidney, liver, lung, proventriculus, and cecum were collected for the detection of goIFNLR1 expression by qRT-PCR. As shown in Figure
Expression of IFNLR1 in various goose tissues. (a) Expression of goIFNLR1 in the epithelial related tissues, including small intestine (SI), cecum (Ce), liver (Li), lung (Lu), proventriculus (Pr), and kidney (K) collected at the indicated time points, such as one-day-old gosling, one-week-old gosling, two-week-old gosling, four-week-old gooses, and adult gooses (beyond one year). (b) Expression of goIFNLR1 in the immune tissues, including spleen (SP), thymus (T), harderian gland (HG), bursa of fabricius (BF), and cecal tonsil (CT); goIFNLR1 mRNA was measured in qRT-PCR and normalized against the housekeeping gene (goose
Five immune tissues, including spleen, Cecal tonsil, harderian gland, thymus, and bursa of fabricius, were collected for the detection of goIFNLR1 expression by qRT-PCR. As shown in Figure
China has the largest breeding population of waterfowl in the world, and aquatic birds are the natural reservoirs for many viruses, including many that cause significant morbidity and mortality, such as avian influenza virus (AIV), and are in charge of the transmission and dissemination of pathogens [
Towards a better understanding of goose type III interferon system, we described goIFNLR1 cDNA from the Sichuan White Goose for the first time in this study. The protein sequence of goIFNLR1 was highly conserved with the sequence from other avian especially with duck (90%) (Table
There are considerable differences in the tissue distribution characters between IFNAR and IFNLR1. It is reported IFNAR shows a ubiquitously expression. However, in mammals and amphibians such as human, bat, and
For a better understanding of the developmental expression of goIFNLR1 in vivo, the qRT-PCR detection of goIFNLR1 gene in epithelial related tissues and immune defense related tissues of five age brackets (one-day, one-week, two-week, four-week, and adult) were accessed here. In various groups, the epithelial related tissues have a relatively high expression of goIFNLR1 when compared to the immune tissues. Among all epithelial related tissues, small intestine shows a higher expression level of goIFNLR1 during the whole developmental stage, and expression level peaked at the one-week time point. One of the reasons is maybe related to the maternally transmitted resistance. Many investigators reported that the immune system of young birds was inherited by their master tape in embryonic period [
Further investigation of goIFNLR1 expression level in the immune tissues found that goIFNLR1 has a relatively high expression level in harderian gland and cecal tonsil compared to other immune tissues. The possible explanation was both cecal tonsil and harderian gland are open immune tissues, the group as mucosa-associated lymphoid tissue that play a critical role against the virus invasion. Moreover, a lower expression level was shown in the spleen, thymus, and bursa of fabricius; one reason may be the immune tissues (thymus and bursa of fabricius) have a degradation with the growth of age in birds.
To our knowledge, this is the first report of the molecular cloning and the feature description of IFNLR1 in the goose, demonstrating that goIFNLR1 has a restricted tissue distribution mainly in epithelial related tissues during the developmental period. This result conform to the tissues distribution character of IFNLR1 gene of other species, and it may shed a light on the type III interferon system mediated antiviral immune responses in aquatic birds. Indeed, further more experiments are needed to better understand the interaction between IFN-
The authors declare no conflict of interests.
Qin Zhou and Shun Chen contributed equally as co-first authors of this work.
This work was funded by National Natural Science Foundation of China (31201891), The Ph.D. Programs Foundation of Ministry of Education of China (20125103120012), Sichuan Provincial Cultivation Program for Leaders of Disciplines in Science (2012JQ0040), Major Project of Education Department in Sichuan Province (12ZA107), Innovative Research Team Program in Education Department of Sichuan Province (nos. 12TD005 and 2013TD0015), National science and technology support program (2015BAD12B05), National Special Fund for Agro-scientific Research in the Public Interest (201003012), and China Agricultural Research System (CARS-43-8).