Farnesyl pyrophosphate synthase (FPPS) plays a vital role in the mevalonate pathway and has been shown to be involved in hypertrophy and cardiovascular diseases. Lentivirus-mediated RNA interference (RNAi) to knock down a gene of interest has become a promising new tool for the establishment of transgenic animals. The interfering fragment, named pLVT202, was chosen from cardiomyocytes tested
To date, it has been shown that farnesyl pyrophosphate synthase (FPPS) plays a vital role in the mevalonate pathway, which is essential for forming cholesterol and isoprenoids. In a key step, FPPS catalyzes the formation of geranyl pyrophosphate (GPP) and farnesyl pyrophosphate (FPP). FPP is an important substrate not only in cholesterol and coenzyme Q biosynthesis, but also in the isoprenylation of small GTPases, such as Ras and Rho. It has been reported that FPPS expression is apparently upregulated in a number of diseases, including solid tumors [
RNAi is a powerful tool for the analysis of gene function in various fields. It is triggered by double-stranded RNA (dsRNA) precursors that vary in length and origin. Lentiviruses are an attractive vehicle for gene transfer, integrating into the genome of nondividing cells. Furthermore, lentivirus-mediated transgenesis has become a basic approach because of the ability to infect embryonic stem cells and preimplantation embryos [
Five individual sequences were designed to interfere with the murine FPPS gene and one nontargeting sequence was used as a control (Table
Sequences of five siRNAs targeting murine FPPS and one nontargeting control.
Vector | Gene | Target sequence | GC% |
---|---|---|---|
pLVT202 | FPPS | GACAGCTTTCTACTCTTTC | 42.1 |
pLVT274 | FPPS | CGCCAGATCTTAGAGGAGAAT | 47.6 |
pLVT275 | FPPS | GCTTTCTTCAAGTATGAGGAA | 38.1 |
pLVT276 | FPPS | GCCATGTGGATCTTGGTAGAT | 47.6 |
pLVT277 | FPPS | GCTTTCTTCCTTGTGTCAGAT | 42.9 |
pLVT7 | NC | TTCTCCGAACGTGTCACGT | 52.6 |
NC: nontargeting control.
(a) Structure of lentiviral vector plasmid pMAGic 7.0. (b) Structure of pLVT vectors. The siRNA fragment was inserted using
Neonatal cardiomyocytes were prepared from the ventricles of 1-2-day-old C57BL/6J mice, obtained from the Experimental Animal Center, Chinese Academy of Sciences (Shanghai, China). The cardiomyocytes were cultured in medium with 10% FBS at 37°C for 24 h before initiating the lentivirus transfection experiment.
Cardiomyocytes were infected at a multiplicity of infection (MOI) of 50 pfu/cell in the culture medium for 72 h at 37°C in a humidified incubator with 5% CO2.
Mice were bred and housed under a 12/12 h light/dark cycle with free access to food and water at the Laboratory Animal Centre of Zhejiang University. The investigation conformed to the Guide for the Care and Use of Laboratory Animals, published by the US National Institutes of Health (NIH Publication Number 85-23, revised 1996), and was approved by the Institutional Animal Care and Use Committee of Zhejiang University.
The lentivirus was microinjected through the zona pellucida into the perivitelline space of zygotes of C57BL/6J mice. The injected zygotes were implanted into the oviduct of pseudopregnant foster mothers. The mice were impregnated and gave birth after the operation. Selected mice were mated with wild-type animals to keep their offspring at heterozygosity.
Transgenic mice were identified by PCR analysis using tail DNA (forward primer 5′-GCAAATGGGCGGTAGGCGTGTA-3′, reverse primer 5′-TCGGGCATGGCGGACTTGAA-3′). PCR conditions were denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 30 s, 54°C for 30 s, and 72°C for 30 s, with a final extension at 72°C for 2 min. The PCR products were electrophoresed on a 1.2% agarose gel (GENE Company, Hong Kong, China).
Total RNA was isolated from homogenized ventricular myocardium using an RNAiso kit (TaKaRa Bio, Tokyo, Japan). After digestion of the RNA with DNase I (TaKaRa Bio), first-strand cDNA was synthesized by reverse transcription (TaKaRa Bio). PCR was carried out with SYBR Premix Ex Taq (TaKaRa Bio) using 5
Sequences of primers used for real-time polymerase chain reaction.
Name | Sequence | Product (bp) |
---|---|---|
Mouse- |
F: 5′-TCATCACTATTGGCAACGAGC-3′ | 399 |
R: 5′-AACAGTCCGCCTAGAAGCAC-3′ | ||
Mouse-FPPS | F: 5′-GGAGGTCCTAGAGTACAATGCC-3′ | 155 |
R: 5′-AAGCCTGGAGCAGTTCTACAC-3′ |
F: forward; R: reverse.
Prepared protein samples (30–50 mg) from several tissues from 6-week-old transgenic and control mice were separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with 5% skim milk in Tween/TBS (TBST) for 1 h and subsequently incubated overnight at 4°C with rabbit polyclonal anti-FPPS antibody (ProteinTech) (1 : 1500 dilution) or mouse monoclonal anti-
Various tissues were dissected from 10-week-old mice and fixed in 10% (v/v) formalin. Sections were made from paraffin-embedded tissue samples, stained with hematoxylin and eosin, examined under a microscope, and photographed. Pathological analysis was carried out in the Department of Pathology, Zhejiang University, China.
The identities of the pLVT vectors were confirmed by PCR and DNA sequence analysis (data not shown), showing that all sequences of the interfering DNA were correctly inserted and linked.
To evaluate the knock-down efficacy of shRNA, western blot analysis was performed. There was a clear decrease in the expression of the FPPS in the lentiviral infection group of pLVT202 compared with the control (about 65% loss), whereas the shRNA pLVT274-277 showed less knock-down efficacy than pLVT202 (Figure
(a) Western blot data of FPPS expression in cardiomyocytes infected with different lentivirus. (b) Relative expression levels of FPPS normalized to
The lentivirus containing the shRNA pLVT202 was microinjected through the zona pellucida into the perivitelline space of 375 fertilized oocytes of C57BL/6J mice. The injected zygotes were implanted into the oviducts of 15 pseudopregnant foster mothers, of which nine became pregnant and gave birth to 37 pups. By PCR analysis, 20 of them showed provirus integration. The ratio of transgenic integration was 54%. There was no apparent difference between the heterozygous mice and the wild-type in gross appearance. The transgenic mice bred normally with the wild-type to give birth to offspring, some of which carried the integrated fragment (Figure
PCR analysis of transgenic mice. (a) Lanes 1, 2, 4, and 5: F1 transgenic mice; lanes 3 and 6–8: nontransgenic mice; lane 9: positive control (pLVT202); lane 10: negative control (wild-type mouse). (b) Lane 1: negative control (wild-type mouse). Lanes 2 and 6-7: F4 transgenic mice; lanes 3–5: nontransgenic mice.
We analyzed FPPS expression in transgenic mice by real-time PCR and western blot analyses. FPPS mRNA and protein expression levels were efficiently downregulated in heart, liver, lung, spleen, kidney, brain, intestine, and skeletal muscle (Figures
(a) Western blot data of FPPS expression in transgenic mice. Left: samples of each tissue were from nontransgenic mice and those on the right were from transgenic mice. (b) Relative expression levels of FPPS normalized to
FPPS expression in transgenic mice. (a) Relative mRNA expression levels of FPPS normalized to
We used PCR to detect transmission of the shRNA allele in offspring mice (Figure
Histological analysis was carried out to determine whether the expression of the FPPS transgene caused any pathological changes. We found no obvious pathological changes in the tissues examined (data not shown). At least in the tissues that we examined, knockdown of FPPS did not cause any pathological consequences in the transgenic mice.
To establish a transgenic RNAi model for the functional study of FPPS
Lentiviral vectors that contain RNAi expression sequences could serve as a fast and effective alternative for the generation of mice with reduced expression of specific genes to the traditional knock-out strategy, which may lead to early embryo lethality, because FPPS is highly expressed during development [
In the present study, we described the establishment of a FPPS downregulation transgenic mouse model via lentivirus-mediated siRNA delivery. We demonstrated that FPPS downregulation was widespread, in multiple tissues of the transgenic mice. Interestingly, the expression of FPPS we observed in myocardium
In summary, we successfully developed a FPPS knock-down mouse model using RNAi. Once the effects of FPPS knockdown are confirmed
From this present study, we can conclude the following. The lentiviral shRNA of pLVT202 was the best choice for downregulating the FPPS gene We observed that 20 offspring mice showed provirus integration by PCR analysis. The frequency of transgenic integration was 54%. We successfully developed a FPPS knock-down mouse model using RNAi. FPPS downregulation was widespread in multiple tissues of the transgenic mice. The transmission of the lentivirus-mediated silencing cassette was stable and continuous suppression by RNAi was observed in our mouse model.
All authors declare that they have no conflict of interests regarding the publication of this paper.
Jian Yang and Chen-Ze Zhao contributed equally to the work.
This work was supported by the National Natural Sciences Foundation of China (Project Nos. 81170242, 81400295, and 81200191), the Research Fund of the Health Agency of Zhejiang Province (No. 2014KYB099), and the Zhejiang Provincial Natural Science Foundation of China (No. LQ14H020004).