Testing for the presence of genetically modified material in seed samples is of critical importance for all stakeholders in the agricultural industry, including growers, seed manufacturers, and regulatory bodies. While rapid antibody-based testing for the transgenic protein has fulfilled this need in the past, the introduction of new variants of a given transgene demands new diagnostic regimen that allows distinguishing different traits at the nucleic acid level. Although such molecular tests can be performed by PCR in the laboratory, their requirement for expensive equipment and sophisticated operation have prevented its uptake in point-of-use applications. A recently developed isothermal DNA amplification technique, recombinase polymerase amplification (RPA), combines simple sample preparation and amplification work-flow procedures with the use of minimal detection equipment in real time. Here, we report the development of a highly sensitive and specific RPA-based detection system for Genuity Roundup Ready 2 Yield (RR2Y) material in soybean (
The amplification and detection of signal from nucleic acid targets to test for the presence of specific genetic markers in sample material are of ever increasing importance in a vast array of application areas. These include trait detection applications in the agricultural sector, as well as clinical diagnostics, testing for food-borne pathogens, environmental testing, and many others [
Collectively, the field of nucleic acid based testing may be termed “molecular diagnostics,” and its central step most often consists of nucleic acid amplification techniques (NAATs). NAATs owe their increasing popularity to their extremely high sensitivity, specificity, speed, and operational simplicity. NAATs, in fact, increasingly complement or may replace traditional methods such as culturing techniques [
Since its inception in the late 1980s, the polymerase chain reaction (PCR) has been the mainstay technique for the amplification of nucleic acids. Although PCR-based testing in laboratories is well established and extremely successful, the reliance of PCR on precise thermal control (at relatively high and rapidly changing—or “cycling”—temperatures; Figure
Target specific amplification of a DNA sequence using RPA. (a) Schematic of PCR and RPA processes. RPA uses recombinases and polymerase to bind and elongate the primers at a constant temperature resulting in the duplication of the target sequence. Multiple events of such duplication lead to exponential amplification under isothermal condition. On the other hand, PCR relies on thermal cycling and heat-stable polymerase for the amplification of the target sequence. (b) Organization of sequences at the site of RR2Y insertion in the conventional and RR2Y soybean genomes. (c) Arrangement of primers and probe used for RPA mediated amplification and detection of the RR2Y specific insertion.
The expansion of molecular diagnostics from centralized laboratories into POU-type scenarios such as the one proposed in this publication requires the integration of NAAT platforms into low-cost and low-complexity devices with simple operating procedures. The isothermal NAAT RPA is ideally positioned to enable such solutions. RPA combines constant low reaction temperature with high sensitivity, specificity, and reaction speed. Briefly, in RPA, the sequence of biochemical events that facilitate the amplification of specific DNA fragments include binding of oligonucleotide primers to the target, extension of the bound primers by a DNA polymerase, and dissociation of the amplified product under isothermal condition (Figure
As part of the RPA reaction, oligonucleotides used for amplification are mixed with DNA binding proteins (GP32, UvsX, and UvsY) resulting in formation of filaments of protein coated oligonucleotide complexes. Binding of GP32 to the oligos is followed by UvsY and finally UvsX, the recombinase. The UvsX/oligo complex searches the template DNA for homologous sequences and subsequently extends the primers. Target amplification is detected with a dual labeled oligonucleotide probe, containing a fluorophore (either TAMRA or FAM) and quencher separated by an abasic site (Table
Sequences of RPA and PCR primers and probes used in the study.
Assay | Description | Sequence |
---|---|---|
RPA | RR2Y probe | cccgccttcagtttaaactatcagtgtttggagc-T(BHQ |
RR2Y forward primer | ccctcttggcttttctaagtttgagctcgttactg | |
RR2Y reverse primer | cccgccttcagtttaaactatcagtgtttgg | |
|
ggaaactgtttctttcagctggaacaag-T(FAM |
|
|
ccagaatgtggttgtatctctctccctaacctt | |
|
cccgaggaggtcacaatagcgtctccttggag | |
|
||
PCR | RR1 forward primer | tttgggaccactgtcggcagaggcatctt |
RR1 reverse primer | gatttgaattcagaaccttgtgca | |
RR2Y forward primer | tcccgctctagcgcttcaat | |
RR2Y reverse primer | tcgagcaggacctgcagaa | |
|
gtttgacactttccggaactcttg | |
|
ctgtcacatttagatggcctcatg |
RPA has been successfully employed in a number of reports for both human IVD [
In order to constitute a fully integrated diagnostic system for the detection of genetic traits, the chosen sample processing procedure and the RPA biochemistry have to be augmented by a compatible read-out approach that is capable of monitoring a signal generated by the target amplification event and thus delivering the diagnostic information. Moreover, this detection method has to maintain the overall operational simplicity and portability of the complete POC system. An extremely useful tool to achieve these requirements is the use of a novel type of fluorogenic oligonucleotide probe specifically designed for RPA, in combination with appropriate fluorescence detection equipment. This approach is described in greater detail elsewhere [
One potential application for the use of NAAT-based diagnostic devices is to develop field detection methods for genetically modified (GMO) crops. Since the first commercialization in the USA in 1996, millions of farmers demonstrate confidence in the benefits of GMO crops as evident by high adoption rates [
As part of the stewardship efforts supporting the commercialization of GM crops, international organizations such as BIO (Biotechnology Industry Organization) developed policy guidance documents (
Protein-based lateral-flow devices (LFD) are the current gold standard for the rapid, on-site test format for GMO sample screening [
Monsanto’s Genuity Roundup Ready 2 Yield (RR2Y) and its predecessor Roundup Ready® soybean present a unique case study for the application of RPA technology to distinguish the two products at the molecular level. The unique protein expressed in RR1 and RR2Y soybean is the same CP4 EPSPS, preventing the use of protein-based LFD method to differentiate the two products.
The current publication reports the use of new NAAT-based technology platform to develop a field detection method, using RR2Y-specific assay as an example. This represents the development of a rapid and inexpensive field-deployable detection method that can effectively differentiate between samples from different GMO events, in this case RR1 and RR2Y soybean that express the same CP4 EPSPS protein. The report also demonstrates the ease and reliability of the method starting from a laboratory sample such as purified DNA template or whole seed sample encountered in a field.
Typically, 100 seeds were collected and crushed in Oster Blender (Model 4655; 600 watt, 3 speeds) with ice crushing blade (#4961 USA). One scoop (~90 mg) of the seed powder was transferred to a tube containing 4 mL of lysis buffer (0.2 M NaOH). Each tube was shaken for approximately 5 seconds and incubated at room temperature (RT) for 1 minute to let the particulates settle down.
DNA was extracted from ground seed using the ZE Plant/Seed DNA miniprep
Oligonucleotide primers and probes used to develop the RPA assays were purchased from Biosearch Technologies (Novato, CA). The RPA reactions were typically carried out at 39°C, unless otherwise noted, using a device that maintains constant temperature combined with fluorescence detection (Twista®, TwistDx, UK). Reaction contents were mixed prior to amplification and again at five minutes during incubation. The output of the reaction was monitored in real time using the Twista Studio Software (TwistDx, UK) with fluorescence measurements taken every 20 seconds for a total of 15 (or 20) minutes [
RPA assays with purified DNA as the template were performed as described below. Lyophilized RR2Y RPA Exo pellets were obtained from TwistDx. The RR2Y RPA Exo pellets comprised all essential components including the critical recombinase and polymerase proteins, such as 900 ng/
Preassigned cutoff values are determined based on statistical analysis of a large set of data. These cutoff values are used to generate an algorithm that can translate the fluorescent amplification curves into positive/negative/invalid calls by the Twista fluorescent reader. The algorithm considers background fluorescence values, onset of amplification, and the strength of the signal between two defined time points (5–8 minutes) to determine the results of the assay. Using this algorithm, Twista can report the assay results without any manual intervention.
PCR amplification was carried out in a thermocycler (Eppendorf Mastercycler Personal) using the following primer pairs.
The oligonucleotide primers were purchased from Integrated DNA Technologies (San Diego, CA).
PCR amplification of RR1 and
The PCR products were mixed with 10x BlueJuice
For lateral-flow strip experiments, conventional, RR1, and RR2Y soybean were tested in triplicate with the QuickStix
To determine long-term stability of RPA reaction pellets at different temperatures, all experimental parameters such as template, buffers, analyst, protocol, and detection devices were kept constant. Reaction pellets were stored at four different temperatures: ≤−15°C (reference), 2–8°C, 22–28°C (ambient), or 35–40°C. Reaction pellets were produced as a single batch, packaged in a dry-room facility as strips of 8 PCR tubes, vacuum-sealed, and shipped on dry ice. The ≤−15°C, 2–8°C, and 22–28°C (ambient) storage units were tracked via an automated system to ensure accurate temperatures. The 35–40°C storage unit was tracked on a weekly basis by manual recording. The reaction pellets from all four temperature conditions were tested at 18 defined intervals over a year.
At each time point, eight reactions were tested per storage condition including six reactions using 0.1% RR2Y genomic DNA as positive control template and two reactions using genomic DNA from conventional soybean. Positive, negative, or invalid calls were made based on a slope cutoff of 90 mV/min for FAM and 600 mV/min for TAMRA. Statistical analysis was used to determine overall results of stability experiments using the following analysis of variance (ANOVA) model:
Pairwise comparisons of each time point to time zero were defined within the ANOVA model and tested using Dunnett’s test at the 5% level. There were multiple cases where statistical significance did not indicate a lack of stability. For example, a significantly lower response at time
This report describes an assay designed to detect a DNA sequence of a genetic element in the soybean genome coding for CP4 EPSPS that confers tolerance to the herbicide Roundup®.
The assay described here is designed in a duplex format to allow simultaneous amplification and detection of the RR2Y insertion and the endogenous soybean gene, lectin (
The DNA junction between the soybean genome and the inserted CP4 EPSPS cassette is well characterized, allowing RPA oligonucleotide primers and probes to be designed to detect the “junction sequences” unique to RR2Y. Figure
RPA reactions for RR2Y and
RPA mediated target specific amplification of RR2Y soybean DNA sequences. (a) Specificity of RPA mediated amplification of the endogenous
PCR reactions were performed with the same purified genomic DNA as above to confirm the identity of the samples. The PCR products were separated in an ethidium bromide stained agarose gel and visualized under a UV transilluminator (Figure
Table summarizing the expected sizes of the amplification products and experimental results of PCR and RPA mediated amplification reactions.
Assays | Expected size (bp) | Conv | RR1 in Conv | RR1 | RR2Y in RR1 | RR2Y in Conv | RR2Y | NTC |
---|---|---|---|---|---|---|---|---|
RR1 PCR | 275 |
|
|
|
|
|
|
|
RR2Y PCR | 139 |
|
|
|
|
|
|
|
|
400 |
|
|
|
|
|
|
|
RR2Y RPA | N/A |
|
|
|
|
|
|
|
The specified level of discrimination of the RR2Y assay is to detect 0.5% (w/w) of RR2Y material in a mixture with 99.5% of non-RR2Y (conventional or RR1) soybean seed material. Due to the nature of the sample preparation procedure, in practice about 10–30 ng of total soybean DNA was analyzed per RPA reaction which corresponds to about 4000–12000 copies of genomic DNA. In a typical reaction at the specified discrimination level of 0.5% (w/w), 20–60 copies of the RR2Y target may be present to act as template for RPA. The copy numbers were calculated based on the genome size of soybean. In order to meet this requirement, first, the sensitivity of the RR2Y analyte detection must be high enough to be able to detect as low as 20 copies per reaction and, second, the assay must perform without significant loss of sensitivity, even in the presence of a comparatively large amount of total soybean DNA.
The sensitivity of the duplex RPA formulation was assessed by challenging it with different amounts of target DNA purified from RR2Y soybean seed samples as template (between 100 and 10 copies per reaction; see Figure
Sensitivity of RPA mediated target amplification. Duplex assays were performed with primers specific for endogenous
The two individual RPA reactions of the combined duplex assay (RR2Y and
Next, a series of experiments was conducted to analyze the robustness of the RPA assay using RR2Y soybean DNA template to determine its usability at the POU settings. Any assay that is to be deployed at such settings must be robust enough to provide consistent performance across varying conditions.
RPA reactions using the purified RR2Y DNA template at different temperatures were used to assess the effect of varying assay temperatures (37°C, 38°C, 40°C, 41°C, and the recommended 39°C) on the performance of the assay (Table
RPA assays were performed at the optimized target temperature of 39°C or at temperatures ±2°C of the target. Robust amplification was observed at all the temperatures tested.
Temperature (°C) | Onset time (min; |
---|---|
37 | 6.3–7.3 |
38 | 5.7–6.7 |
39 | 5.7–6.3 |
40 | 5.3–6.0 |
41 | 5.3–5.7 |
A time course experiment was performed to address the long-term storage stability of the RPA formulation. Many of the reagents that are critical for the RPA assay performance (such as proteins, oligonucleotides, and nucleotides) are potentially unstable, some of them even under refrigerated conditions, and are, therefore, provided in a lyophilized format as preformulated reaction pellets in microcentrifuge PCR strip tubes. Each strip of lyophilized RPA pellets was vacuum-sealed in a foil pouch. Sealed strips of lyophilized RPA reaction pellets were stored at different temperatures: in a freezer (<−15°C), in a refrigerator (2–8°C), at room temperature (RT; 22–28°C), and in an incubator (35–40°C). Eight reaction tubes from the respective storage temperature were tested for assay performance at regular intervals over a period of one year. RPA assays for the
Robustness and stability of RPA reactions. (a, b) Long-term stability testing of the lyophilized RPA reaction pellets. Pellets were stored at different temperatures for up to one year and assays were conducted every three weeks. Dunnett test at 5% level was performed and mean fluorescence was plotted against time.
To test the feasibility of RPA in POU setting, we performed a set of experiments. The current benchmark for field testing involves protein-based LFD that detects the presence of the target protein in crude seed extracts (Figure
RPA-based field detection method. (a) Protein-based lateral-flow strips were used to detect conventional, RR1, and RR2Y yield soybean extracts. Genetic modification in the RR1 and RR2Y events produces the unique CP4 EPSPS protein not observed in the conventional soybean. (b) Flow chart depicting the sample processing and assay setup steps to perform the protein-based and RPA-based field detection methods. (c) Specificity and sensitivity of RPA-based RR2Y event specific amplification using crude seed extracts as the templates. Endogenous
All samples tested showed positive amplification for the
In a POU setting, end-users will not need to analyze the reaction curves to determine the result of a test. Instruments and the associated software used to perform the current assay were developed so that the results of each of the reactions could also be analyzed by an algorithm preprogrammed and displayed on the screen as + (positive), − (negative), or ? (invalid) at the end of the reaction (data not shown). Results from the screen display matched the amplification curves (data not shown), as expected.
In summary, the present studies demonstrate that RPA-based field detection assays can be fast and simple and performed by a relatively untrained user. The ability of RPA assays to detect DNA sequences unique to GMO crops provides an advantage over LFD for GMO crops that share the same protein. RPA assays also have intrinsic advantages over PCR assays. RPA assays are simpler, easier, and faster than PCR assays for an end-user. Instrumentation used for the RPA-based assays is relatively cheaper than a PCR thermocycler, largely owing to the isothermal nature of the RPA reaction. In particular, the current report presents an RPA-based field detection method that can specifically detect RR2Y soybean. The assay was developed in a duplex format allowing simultaneous detection of the endogenous
Detection of a number of novel traits could benefit from employing RPA, including RNA interference-based traits where the inserted DNA in the transgenic event does not encode a protein (Vistive® Gold Soybean). RPA technology provides benefit to products with multiple stacked traits by delivering insertion-specific detection of the individual traits. The technology offers a significant breakthrough for the development of detection methods at the elevators and ports and in the field to ensure regulatory and product stewardship compliance and validate product claims.
All authors are or were affiliated with the Monsanto Company or TwistDx. They are not aware of any other affiliations, memberships, funding, or financial holdings that might be perceived as affecting the objectivity of this paper.
The authors would like to thank Elizabeth Gohara, Bradley Storrs, Jackie Kobe, Tiffany Stephans, Traci Mayfield, David Grothaus, Rebecca Bobula, Allen Christian, Jay Butka, and Mingqi Deng for their contributions. This work was supported by Monsanto Company and TwistDx. Both Monsanto Company and TwistDx provided support in the form of salaries for all authors, as well as logistical and scientific support. They also played a role in the design, data analysis, and the decision to publish.