Epilepsy is one of the most devastating neurological diseases and despite significant efforts there is no cure available. Occurrence of spontaneous seizures in epilepsy is preceded by numerous functional and structural pathophysiological reorganizations in the brain—a process called epileptogenesis. Treatment strategies targeting this process may be efficient for preventing spontaneous recurrent seizures (SRS) in epilepsy, or for modification of disease progression. We have previously shown that (i) myoinositol (MI) pretreatment significantly decreases severity of acute seizures (status epilepticus: SE) induced by kainic acid (KA) in experimental animals and (ii) that daily post-SE administration of MI for 4 weeks prevents certain biochemical changes triggered by SE. However it was not established whether such MI treatment also exerts long-term effects on the frequency of SRS. In the present study we have shown that, in KA-induced post-SE epilepsy model in rats, MI treatment for 28 days reduces frequency and duration of behavioural SRS not only during the treatment, but also after its termination for the following 4 weeks. Moreover, MI has significant effects on molecular changes in the hippocampus, including mi-RNA expression spectrum, as well as mRNA levels of sodium-MI transporter and LRRC8A subunit of the volume regulated anionic channel. Taken together, these data suggest that molecular changes induced by MI treatment may counteract epileptogenesis. Thus, here we provide data indicating antiepileptogenic properties of MI, which further supports the idea of developing new antiepileptogenic and disease modifying drug that targets MI system.
Epileptogenesis is a dynamic and multifactorial process of molecular, cellular, and functional reorganization in the brain that follows the precipitating events or insults that lead to epilepsy—a disease which is characterized by spontaneous recurrent seizures (SRS) [
In Chinese and Tibetan folk medicine, some native plants of the
In the previous series of experiments, we demonstrated that MI pretreatment significantly decreases severity of acute seizures induced either by pentylentetrazolium (PTZ) or by kainic acid (KA) in experimental animals [
In the present study, we hypothesized that the MI-induced normalization of biochemical alterations during epileptogenesis can lead to disease modification and decrease SRS frequency and duration in the chronic phase of epilepsy. In particular, we investigated whether 4 week post-SE MI administration exerted long-term effects on the frequency and duration of SRS after the termination of the treatment, and this was accompanied by the molecular changes in the hippocampus. Rats were treated by MI for the first 28 days after KA-induced SE and decapitated after additional 4 weeks for further biochemical analysis. During the entire period, animals were continuously video monitored for frequency and duration of behavioural SRS.
The rationale of biochemical studies has been the following: (i) MI is accumulated into the cells by sodium-myoinositol transporter (SMIT). SMIT mRNA is upregulated in the rat brain at least for 12h after the onset of KA-induced seizures [
In support of our hypothesis, we demonstrate that (i) frequency and duration of SRS are significantly reduced in MI-treated animals as compared to KA+Saline (KA+SAL) group during 8 weeks after SE; (ii) expression of SMIT is upregulated in the hippocampus in KA+SAL and in KA+MI groups, with the significantly highest level in MI-treated group; (iii) expression of LRRC8A is increased only in KA+SAL group whereas in MI-treated animals LRRC8A maintains the same control level; (iv) various changes in mi-RNA spectrum have been observed in the KA+SAL and KA+MI groups comparing to control groups. It is noteworthy that some of the miRNAs in MI-treated group remain on the same level as in the control group.
Male Wistar rats, 2.5–3 months of age, received a single intraperitoneal injection (IP) of KA (10mg/kg, Abcam) dissolved in saline. After injection, each animal was placed into an individual plastic cage for observation for 4 hours. Seizures were scored according to a modified Racine scoring system from 0 to 6: (0) no motor seizures; (1) freezing, staring, mouth, or facial movements; (2) head nodding or isolated twitches, rigid posture; (3) tail extension, unilateral–bilateral forelimb clonus; (4) rearing, in which the mice sit in an immobile state on their rear haunches with one or both forepaws extended; (5) clonic seizures, loss of posture, jumping, and forepaws extended; (6) tonic seizures with hind limb extension [
Half of selected KA treated rats were treated with MI (30mg/kg, KA+MI group) and another half with saline (0.9% NaCl sterile solution, 1 mL/kg KA+SAL group). IP injections (twice per day) started 4 hours following KA treatment and continued for 28 days.
Control animals were treated with saline and then divided into two groups: one group received twice daily saline injections (0.9% NaCl sterile solution, 1 mL/kg, and CON+SAL group) and the other group twice daily MI injections (30mg/kg, CON+MI group). Injections lasted for 28 days, like in case of KA treated animals.
The diagram of experimental design is provided in Figure
The diagram of experimental design.
Animals were housed individually and maintained under 12 h light/12 h dark cycle. Animal behaviour was 24/7 monitored by closed-circuit infrared video cameras (
For miRNA profiling RNA was isolated from hippocampus by miRNeasy Mini Kit (Qiagen, 217004). This kit is useful for the isolation of total RNA including small RNAs. The concentration of RNA was measured by absorbance at wavelength 280/260nm on Nanodrop.
The RNA isolation for miRNA quantitative measurement, as well as for SMIT and LRRC8A mRNA measurements, was carried out by the same miRNeasy Mini Kit.
miRNA profiling experiments were done on hippocampi of three groups of rats: CON+SAL, KA+SAL, and KA+MI, with 5 animals in each group. miRNA profiling was performed using a service provider (LC Sciences). One
For the measurement of the selected mi-RNA (miRNA 6216), samples from the following 4 groups of rats were used: CON+SAL, CON+MI, KA+SAL, and KA+MI. The RNA fractions from hippocampus and neocortex were reverse transcribed by Taqman MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific 4366596). The amount of miRNA 6216 was measured by TaqMan™ assay kit from Thermo Fisher (Assay ID-471281_mat, Thermo Fisher Scientific) using Step One Real-Time PCR System (Applied Biosystems) and normalized to the amount of the two following miRNAs: miR-23b-3p (Assay ID 245306_mat, Thermo Fisher Scientific) and miR-361-5p (Assay ID 000554,Thermo Fisher Scientific. For selection of housekeeper microRNAs see “Results”). The comparative CT (ΔΔCT) method was used to determine the relative target quantity in samples [
Complementary DNA (cDNA) from the RNA fractions of hippocampus and neocortex was synthesized by RETROscript Reverse Transcription kit for RT_PCR (Thermo Fisher Scientific AM 1710). Relative SMIT and LRRC8A cDNA copy number was determined by real-time PCR using the Step One Real-Time PCR System (Applied Biosystems) with the SYBR Green detection method and was normalized to the beta-actin. The following primers were used: LRRC8A: Forward primer: GCACCAACAGCCAACACAAAG Reverse primer: GGAGTCGTTGCAGGAGTCTT SMIT: Forward primer: TGG TGA CGA AGG AGA GTT GC Reverse primer: AGG TTG GAG CCC CTT AAT GC Reverse primer 5′: CTCCGGAGTCCATCACAATG-3.
HMGB1 was determined in the hippocampus and neocortex as well as in the blood plasma samples from the following 4 groups of rats: CON+SAL, CON+MI, KA+SAL, and KA+MI. Brain tissue samples were rapidly homogenized in 20mM Tris-HCl (pH 7.4), 0.32M sucrose, 1mM Methylendiamintetraacetic acid, 1mM sodium orthovanadate, 10mM sodium pyrophosphate, 0.5mM ethylene glycol-bis (2-aminoethylether)-N,N,N’,N’- tetraacetic acid, and a cocktail of protease inhibitors (Sigma, P8340).
The protein concentration was determined in brain tissue homogenate fraction as well as in plasma fractions in quadruplicate, using a micro bicinchoninic acid protein assay kit (Pierce).
Equal volume aliquots, containing 30
Data were not normalized with respect to any other housekeeping protein in brain tissue samples, because it cannot be guaranteed that such proteins are not affected by KA treatment [
The data of seizure frequency and duration were analyzed by one-way ANOVA, with factor-treatment (KA+SAL or KA+MI). Analysis was done on the one hand for 8 weeks in total and, on the other hand, for the first the last 4 weeks separately. In case of significant effect in ANOVA, planned comparisons were done by two-tailed t-test.
Study of changes in the amounts of miRNA 6216 and SMIT and LRRC8A mRNAs was carried on the following groups of rats: CON+SAL, CON+MI, KA+SAL, and KA+MI. In sum, data were obtained from 36 rats (9 animals per group) from three standard experimental series. To eliminate unavoidable variations between experimental series, the RNA data were divided on the mean of the corresponding experimental series. The data were then analyzed by one-way ANOVA, with factor-treatment (CON+SAL, CON+MI, KA+SAL, and KA+MI). In case of significant effect in ANOVA, planned comparisons were done by two-tailed t-test.
HMGB1. The amount of HMGB1 was determined in the following groups of rats: CON+SAL, CON+MI, KA+SAL, and KA+MI. Each group consisted of 5 animals from two series of experiments. The statistical analysis was done as in case of miRNA and mRNA experiments.
One-way ANOVA analysis revealed a significant effect of MI treatment on the mean number of SRS per animal during 8 weeks of observation (F1,86=12.25, P=0.001). The mean number of SRS per animal was nearly three times less in MI-treated group of rats as compared to the KA+SAL group (T = 3.50 P-Value = 0.001 85 DF, Figure
Mean number of SRS per animal during all 8 weeks (a); during MI and SAL treatment (I-IV weeks) (b); after MI and SAL treatment termination (V-VIII weeks) (c).
Analyzing data by two separate 4-week time frames has shown that the effect of MI treatment was significant for both periods—for the first 4 weeks as well as for the following 4 weeks, when the MI treatment had already been discontinued (correspondingly F 1,86= 7.16, P=0.009 and F 1,86=14.59, and P<0.0001). The mean number of SRS per animal was significantly lower in MI-treated group for both periods (correspondingly T = -2.68 P = 0.009 85 DF and T = 3.82 85 DF, P< 0.0001). These differences were even more pronounced for the second 4-week period (Figures
MI treatment for 4 weeks had also a significant effect on total time that animals spent in seizure (sum of all SRS durations) during all 8 weeks of experimental period (one-way ANOVA, F1,86=13.41 P<0.0001). The mean total SRS duration (sum of all SRS durations divided on the number of animals in the group) in MI-treated rats was significantly less comparing to KA+SAL group (T= 3.66 85 DF P < 0.0001, Figure
Mean total duration (seconds) of SRS per animal during all 8 weeks (a); during MI and SAL treatment (I-IV weeks) (b); after MI and SAL treatment termination (V-VIII weeks) (c).
In the hippocampus, SMIT mRNA levels were significantly changed by experimental conditions (one-way ANOVA F 3,35=30.11 P<0.0001). The highest mean levels of SMIT mRNA were observed in KA+MI group, which significantly exceeded other three groups (KA+MI vs KA+SAL T = 5.09 16 DF P < 0.001; KA+MI vs CON+SAL T = 6.00 16 DF P< 0.001; KA+MI vs CON++MI T = 6.17 16 DF P< 0.001). The mean levels of SMIT mRNA in KA+SAL group were significantly higher than in CON+SAL group (T= 2.30, 16 DF P= 0.035) and CON+MI group (T = 2.80 16 DF P = 0.013), Figure
The mean relative levels of SMIT mRNA in hippocampus (a) and in neocortex (b).
In the neocortex no significant difference was observed in SMIT mRNA levels between the groups (Figure
One-way ANOVA revealed that experimental treatment had significant effect on LRRC8A levels in the hippocampus (F3,35= 6.92 P=0.001). The mean relative amounts of LRRC8A mRNA were significantly higher in KA+SAL group as compared to other three groups (KA+SAL vs KA+MI T= 2.43 16 DF P =0.027; KA+SAL vs CON+SAL T= 3.06 16 DF P= 0.007 and KA+SAL VS CON+MI T=2.96 16 DF P = 0.009; Figure
The mean relative amounts of LRCC8A mRNA in hippocampus (a) and in neocortex (b).
No significant difference was detected in LRRC8A mRNA levels between the groups in the neocortex (Figure
Changes in mi-RNA spectrum were studied in the hippocampus of three groups of rats: CON+SAL, KA+SAL, and KA+MI. Nearly 70 miRNAs displayed significant differences (p<0.05) between the groups to either direction (for full outcome of data analysis see Supplementary material: Supplementary Table
List of miRNAs (with normal signal) that show statistically significant differential expression in hippocampi of the following groups of rats: KA+SAL vs CON+SAL (a), KA+ MI vs CON+SAL (b), and KA+MI vs KA+SAL (c).
mi-RNA | Log2 (KA+SAL/CON+SAL) | P value |
---|---|---|
rno-miR-494-3p | 1.03 | 0.0053 |
rno-miR-100-5p | 0.29 | 0.0083 |
rno-miR-582-5p | 0.41 | 0.012 |
rno-miR-181a-5p | -0.41 | 0.020 |
rno-miR-652-3p | -0.56 | 0.024 |
rno-miR-28-5p | 0.70 | 0.032 |
rno-miR-129-1-3p | 0.99 | 0.037 |
rno-miR-664-3p | 0.83 | 0.039 |
rno-miR-150-5p | 0.27 | 0.0485 |
mi-RNA | Log2 (KA+MI/CON+SAL) | P value |
---|---|---|
rno-miR-27a-3p | 0.8 | 0.0012 |
rno-miR-135a-5p | 2.28 | 0.0014 |
rno-miR-582-5p | 0.61 | 0.0023 |
rno-miR-341 | 1.49 | 0.0033 |
rno-miR-329-3p | -0.7 | 0.0072 |
rno-miR-494-3p | 1.16 | 0.0080 |
rno-miR-181d-5p | 0.96 | 0.0134 |
rno-miR-543-3p | -0.43 | 0.0168 |
rno-miR-137-3p | 0.70 | 0.0185 |
rno-miR-27b-3p | 0.26 | 0.0197 |
rno-miR-434-3p | -0.53 | 0.0218 |
rno-miR-384-3p | 0.51 | 0.0250 |
rno-miR-30a-5p | 0.37 | 0.0287 |
rno-miR-195-5p | 0.60 | 0.0297 |
rno-miR-376b-5p | -0.4 | 0.0338 |
rno-miR-433-3p | -0.57 | 0.0373 |
rno-miR-187-3p | -0.82 | 0.0379 |
rno-miR-138-5p | -0.68 | 0.0383 |
rno-miR-652-3p | -0.48 | 0.0410 |
rno-let-7a-1-3p | 0.85 | 0.0412 |
rno-miR-485-5p | -0.84 | 0.0438 |
mi-RNA | Log2 (KA+MI/KA+SAL) | P value |
---|---|---|
rno-miR-329-3p | -0.89 | 0.0015 |
rno-miR-341 | 1.52 | 0.0028 |
rno-miR-352 | -0.64 | 0.0055 |
rno-miR-434-5p | -0.42 | 0.0068 |
rno-let-7e-5p | -0.71 | 0.0071 |
rno-miR-181a-5p | 0.29 | 0.0078 |
rno-miR-126a-3p | 0.33 | 0.0106 |
rno-let-7d-5p | -0.57 | 0.0157 |
rno-miR-30a-5p | 0.32 | 0.0165 |
rno-miR-485-5p | -0.73 | 0.0178 |
rno-miR-494-5p | 1.32 | 0.020 |
rno-miR-27b-3p | 0.33 | 0.0267 |
rno-miR-3596a | 3.27 | 0.0290 |
rno-miR-27a-3p | 0.51 | 0.0381 |
rno-miR-6216 | 2.95 | 0.0357 |
rno-miR-664-3p | -0.69 | 0.0373 |
rno-miR-181c-5p | 1.44 | 0.0388 |
rno-miR-185-5p | -0.29 | 0.0442 |
rno-let-7a-1-3p | 0.78 | 0.0452 |
rno-miR-129-2-3p | -0.90 | 0.0453 |
rno-miR-129-1-3p | -1.19 | 0.0468 |
rno-miR-150-5p | -0.33 | 0.0491 |
KA+SAL and KA+MI groups differ significantly from each other by the levels of 22 miRNAs. Changes of 4 of them (marked by
To validate microarray experiments, we focused on those miRNAs that exhibited a minimal signal intensity (500) at least in one of the experimental group samples (see the brochure “Validation of miRNA Microarray Results with Real-Time QPCR”
Validation studies were performed on RNA fraction from hippocampus and neocortex from 4 groups of rats: CON+SAL, CON+MI, KA+SAL, and KA+MI.
One-way ANOVA revealed that the effect of experimental treatment was significant in the hippocampus for both housekeeper miRNAs (for miR-361-5p F3,35=4.85, P=0.007, and for miR-23b-3p F3,35=4.04, P=0.015).
The mean level of miR-6216 in the hippocampus of KA+MI group was significantly higher as compared to KA+SAL group. This difference was valid when data were normalized for both housekeepers (see Figures
The mean relative amounts of rno-miR-6216 in hippocampus and neocortex. (a and b) With housekeeper: rno-miR-361-5p; (c and d) with housekeeper: rno-miR-23b-3p.
Sample film (a) and mean levels (mean ±standard error of the mean) (b) of hippocampus HMGB1 in different groups of rats. Each lane corresponds to one sample. Lanes 1-5 are from CON+SAL group; lanes 6-10 from CON+MI group; lanes 11-15 from KA+SAL group; and lanes 16-20 from KA+MI group. Calibration plots (lines fitted by linear least-squares regression) (c) and internal standards sample film (containing, respectively, 15, 30, 45, and 60
No significant changes were revealed by ANOVA (Figures
Anti-HMGB-1 antibodies bind to a band of protein with molecular weight of 25 Kda (Figures
Sample film (a) and mean levels (mean ±standard error of the mean) (b) of plasma HMGB1 in different groups of rats. Each lane corresponds to one sample. Lanes 1-5 are from CON+SAL group; lanes 6-10 from CON+MI group; lanes 11-15 from KA+SAL group and lanes 16-20 from KA+MI group. Calibration plots (lines fitted by linear least-squares regression) (c) and internal standards sample film (containing, respectively, 15, 30, 45, and 60
Four standards (15, 30, 45, and 60
No significant changes were found with one-way ANOVA in hippocampal, or plasma HMGB1 levels (Figures
The present results for the first time demonstrate that MI treatment have a long-term effect on KA-induced epileptogenesis: 4-week regular administration of MI, post-KA-induced SE, inhibits the spontaneous behavioural seizures with concomitant changes in molecular profile associated with epileptogenesis. This effect is maintained after termination of MI treatment.
The average number of SRS in the KA+MI group was much lower as compared to the KA+SAL group. This outcome was observed during the whole observation period for 8-weeks, as well as during the two separate periods: throughout actual MI treatment and after its termination. In addition, the total duration of SRS per animal was significantly shorter. Similar to the frequency, decrease in SRS duration was maintained after ceasing MI injections. Thus MI has a long-lasting effect on the process of epileptogenesis.
We have shown that 4-week MI treatment has significant effects on KA-induced molecular changes, which included SMIT and SWELL channel subunit expression, as well as miRNA spectrum.
We have found that the level of SMIT mRNA is significantly increased as compared to control groups in the hippocampus of KA+SAL and KA+MI groups. The level of SMIT mRNA in KA+SAL hippocampus is increased nearly 2 times as compared to the controls, whereas the increase in KA+MI is much stronger, exceeding control groups 6- and KA+SAL group 3 times. The upregulation of the SMIT mRNA in the hippocampus was also shown shortly after KA-induced SE in rats [
The only significant change in the amount of LRRC8A mRNA was observed in the hippocampus of the KA+SAL group. LRRC8A is one of the subunits of volume regulated anion channel (VRAC), and this channel is important for regulating cell size by transporting chloride ions and various organic osmolytes across the plasma membrane [
Cellular swelling disrupts normal function of various enzymes [
We demonstrate that 4 weeks of MI treatment have long-term influence on mi-RNA spectrum in the rat hippocampus. The miRNA hippocampal profile in KA+SAL and KA+MI groups significantly differ from each other by 22 miRNAs with normal signal expression and 28 miRNAs with low signal expression (see Table
Several miRNAs have been implicated in KA-induced seizures and KA-induced epileptogenesis [
Taken together, all these data indicate that MI treatment alters the profile of KA-induced epileptogenesis as assessed by changes in levels of mi-RNAs that are important in regulation of posttranscriptional gene expression.
No significant changes were found in HMGB1 protein in either hippocampus, or neocortex, or serum in any of the animal groups. We have measured the total amount of HMGB1 protein, which exists in various isoforms reflecting different pathophysiological processes. The disulfide isoform of HMGB1 is generated in the brain during oxidative stress and is implicated in seizures, cell loss, and cognitive dysfunctions [
MI is not only an important precursor to the biosynthesis of inositol phospholipids and inositol phosphates (compounds that play an important role in signal transduction) but also is a physiologically important osmolyte [reviewed in [
In conclusion, our data could open the novel perspectives in MI treatment as a possible preventive strategy in epilepsy by altering the progress of epileptogenesis that warrants further translational studies on MI-based approaches
All miRNA profiling data are available as Supplementary Material, Tables
The authors declare no conflicts of interest.
The research was funded by the Sh. Rustaveli National Science Foundation, Georgia [Grant DI/9/7-222/14].
Table-S1. miRNA profiling data–ANOVA results for the hippocampus miRNA of three groups of rats: CON+SAL, KA+SAL, and KA+MI, Table-S2. Comparison of miRNA expression between two groups of rats: CON+SAL and KA+SAL (t-test), Table-S3. Comparison of miRNA expression between two groups of rats: CON+SAL and KA+MI (t-test), Table-S4. Comparison of miRNA expression between two groups of rats: KA+SAL and KA+MI (t-test).