Polycystic ovarian syndrome (PCOS) is a group of syndromes with multiple pathogenesis and clinical polymorphism and an endocrine and metabolic disorder in women. Reported PCOS incidence ranges from 6% to 20% in different areas, depending on the criteria used [
Studies have shown that acupuncture may be a safe and effective way to treat reproductive endocrine dysfunction in women with PCOS [
In several studies, it has been shown that repeated low-frequency EA rehabilitated estrous cyclicity and regulated gonadotropin-releasing hormone and AR expression in the hypothalamus of rats, regulated u, К receptor mRNA expression, and lowered testosterone levels, while manual stimulation can reduce estrogen, progesterone, and kisspeptin receptor expression [
The prevalence of IR and hyperinsulinemia in PCOS patients is 50%–70% [
Androgen plays its role by binding to the AR. The AR is widely expressed in granulosa cells at the early stage of follicular development, and ARs are abundant in preantral follicles [
In mice, most follicles in the ovaries of mice lacking Connexin 43 (Cx43) stop developing before granulosa cell stratification, resulting in an abnormal follicular structure, vacuolization of oocytes and granulosa cells to a certain extent, inability to resume oocyte meiosis, and the inability of the oocyte to be fertilized [
Previous studies have demonstrated that letrozole-induced PCOS models have characteristics similar to those of human patients, such as hyperandrogenism, LH hypersecretion, follicular dysplasia, and anovulation [
In this study, 30 female Sprague Dawley rats (6 weeks old) were housed in a controlled temperature environment (20–23°C), humidity (40%–60%), and 12 h light : 12 h dark cyclical alternates with ad libitum availability of food and water. All procedures described here were approved by the Animal Ethical Committee of Shanghai University of Chinese Traditional Medicine (Shanghai, China).
Thirty rats with comparable weights (160 ± 20 g) were randomly assigned to three different groups: control group, LE group, and LE group receiving EA (LE + EA group). The PCOS model was established by administering (via gavage) the animals letrozole solution (1.0 mg/kg) once daily for 21 consecutive days. The control group was administered 1% CMC (10 mg/kg) by gavage. During modeling, rats were weighed using a JA 31002 electronic balance (Shanghai Jing Tian Electronic Instrument Co., Ltd., Shanghai, China). From the second day after modeling, the LE + EA group underwent EA treatment for 14 consecutive days. The control and LE groups were not given any treatment, except for fixation.
Estrus cyclicity was monitored daily at 9 AM from the first day after the first administration to the 36th consecutive day by microscopic observation of the type of epithelial cells in the vaginal smear. Vaginal cells were collected via saline lavage, fixed with methanol, and stained with Pap stain. Animals with regular 4-5-day cycles, including proestrus, estrus, postestrus, and diestrus, were defined as normal cyclic rats, whereas those whose estrus cycles stopped for four consecutive days in diestrus phases were termed acyclic rats.
In the LE + EA group, acupoints CV-3 (on the ventral midline at approximately the upper 3/5 and lower 2/5 of the line) and the point 5 mm next to CV-3 at the same horizontal axis were used. We inserted 25 mm acupuncture needles (
On the day after the last EA treatment, the vaginal smears were examined before sampling. We collected blood samples and ovarian tissue samples on the diestrus stage of the estrus cycle and between 8 and 11 AM. Rats that were not on diestrus that day were sampled on a different day when they entered diestrus. Rats were anesthetized with 3% pentobarbital sodium (0.1 ml/100 g of body weight), and then blood samples were obtained from the abdominal aorta after overnight fasting. Blood samples were then centrifuged at
From each rat, ovarian tissue was collected after blood collection, fixed in 4% paraformaldehyde, blocked in paraffin, and cut into serial 4
Serum concentrations of T, E2, FSH, LH, SHBG, AMH, INHB, and FINS were quantified using rat ELISA Kits (Abcam Systems, Cambridge, UK). All experiments were performed following the manufacturer’s instructions. The detection limit was 1.0 pg/mL for T, 0.1 pmol/L for E2, 0.1 IU/L for FSH, 0.1 mIU/L for LH, 0.1 nmol/L for SHBG, 10 pg/mL for AMH and INHB, and 0.1 mU/L for FINS. For all ELISA Kits, the intra- and interassay variations were 10% and 15%. FBG levels were determined using a glucose oxidase kit (Rongsheng Biotech, Shanghai, China).
Total RNA was isolated using TRIsoln reagent (Invitrogen, Carlsbad, CA, USA), and total RNA (2
Primer sequences of targeted genes in rats.
Targeted genes | Forward and reverse primers | Amplification size (bp) | Accession number |
---|---|---|---|
AR | TTTTGAGTTTTGTTGTATT | 173 | NM_012502 |
CTCTCTCTGTTTGTTTCTT | |||
Cx43 | CCACTCTCGCCTATGTCTCC | 110 | NM_012567 |
TAGTTCGCCCAGTTTTGCTC | |||
Gapdh | TCCTGCACCACCAACTGCTTAG | 102 | NM_017008 |
AGTGGCAGTGATGGCATGGACT |
We homogenized each group of rat ovaries in ice-cold RIPA Lysis Buffer (Beyotime, Shanghai, China). Then, sample homogenates were incubated on ice for 30 min and centrifuged (
Experimental data are shown as the mean ± SEM, and statistical analyses were performed using the SPSS software package (SPSS, version 20.0; Chicago, IL, USA). Differences between groups were evaluated using one-way analysis of variance (ANOVA). The LSD test was used for pairwise comparison of homogeneity of variance, and Dunnet’s test was used for heterogeneity of variance.
After modeling, rats administered letrozole displayed abnormal estrous cycles with estrus disappearing on approximately the 12th day and remained in the diestrus stage. All rats in the control group showed normal estrous cyclicity. Thus, the model animal was successfully established. In the LE + EA group, 7 of 10 rats resumed estrous cyclicity, and epithelial keratinocytes in vaginal smear were observed under a microscope during treatment. The remaining 3 rats in this group showed no response to EA treatment until the time of terminal kill. The 10 rats in the LE group were still in the diestrus stage at the time of the terminal kill.
No significant differences were observed in the initial body weight between groups. From the 5th day after modeling to the end of modeling, the increase in body weight of rats in each modeling group was significantly faster when compared to that in the control group (Figure
Body weight and ovarian weight of rats. (a) Changes in body weight during modeling. (b) Pretreatment body weight (on the 21st day). (c) Posttreatment body weight. (d) Ovary weight. Error bars represent the SEM.
The ovarian weight of rats in the LE group significantly increased compared with that of rats in the control group (
In the control group, corpus luteum and follicles at different stages of development were observed. Granulosa cells were arranged in multiple layers within follicles. In the LE group, the surface of the ovary was pale and the capsule was thickened, with cystic follicles protruding. Microscopically, the number of granulosa cell layers in the LE group sections was less, and oocytes and radiating crowns disappeared in the cystic follicles.
Compared with the LE group, the LE + EA group showed a decrease in ovary size as well as a decrease in the number of cystic follicles. Furthermore, an increase in the granulosa cell layer of follicles was observed in the LE + EA group, and submature follicles with cumulus were observed (Figure
Histology of ovaries. Ovaries were stained with hematoxylin and eosin: (a) control group; (b) LE group; (c) LE + EA group; magnification ×400. Scale bars represent 1000
Testosterone levels were significantly elevated in the LE group (
Estradiol levels were significantly decreased in the LE group (
Levels of circulating LH were higher and FSH levels were lower in the LE group compared with those in the control group (
(a) Serum levels of testosterone T, (b) sex hormone-binding globin (SHBG), (c) fasting serum insulin (FAI), (d) estradiol (E2), (e) follicle-stimulating hormone (FSH), (f) luteinizing hormone (LH), and (g) LH/FSH in rats. Error bars represent SEM,
Levels of circulating AMH and INHB were increased in the LE group (
(a) Serum levels of anti-Müllerian hormone (AMH) and (b) inhibin B (INHB) in rats. Error bars represent the SEM,
Compared with the control group, the LE group showed increases in FINS, FBG, and HOMA-IR (
(a) Levels of free androgen index (FINS), (b) fasting blood glucose (FBG), and (c) HOMA-IR in rats. Error bars represent the SEM,
To investigate the localization and expressions of AR and Cx43 in the rat ovary, immunofluorescence was performed on samples in the control group. As shown in Figure
Immunolocalization and expression of the androgen receptor and Connexin43 in the ovary of a control rat. (a-b) Expression and localization of the androgen receptor (AR) in control rat follicles. Positive AR immunostaining was mainly observed in the nuclei of cells at the different developmental stages and corpora lutea (a). Positive AR immunostaining was observed in the nuclei of granulosa cells and theca cells in the antral follicle (b). (c-d) Expression and localization of Cx43 in follicles of control rats. Cx43 was observed as punctuate staining on the borders of granulosa cells in preantral follicles, large antral follicles, preovulatory follicles, and corpora lutea (c). Cx43 displayed punctate to the linear expression on the borders of granulosa cells, between granulosa cells and theca cells, as well as between granulosa cells and oocyte in the preovulatory follicle of control ovary (d). The expression was shown in brown, and the nuclei were stained in blue. PoF, preovulatory follicle; AF, antral follicle; AS, antral space; PF, primary follicle; TC, theca cell; GC, granulosa cell; CL, corpus luteum. Scale bars represent 500
Ovarian mRNA expression of AR and Cx43 was higher in the LE group compared to the control group (
(a) Effects of EA on mRNA expression levels of AR and (b) Cx43 mRNA in ovarian tissues of rats in the three groups. Values are shown as levels of expression relative to that of Gapdh. Error bars represent the SEM,
Protein expressions of AR and Cx43 in ovaries were higher in the LE group compared to the control group (
The effects of EA on AR and Cx43 expression in ovarian tissues of rats in the three groups (
Hyperandrogenism is the basic pathological feature of PCOS and plays an important role in the pathogenesis of PCOS. Androgen excess can lead to a range of clinical symptoms: amenorrhea, hirsutism, acne, and alopecia [
Increased expressions of androgen synthesis catalytic enzymes such as cytochrome P45017
In recent studies, it was shown that AMH and INHB were two major ovarian local regulators involved in the pathogenesis of PCOS [
In our study, we successfully established a rat model of PCOS with the characteristics of polycystic ovaries, obesity, irregular estrous cyclicity, hyperandrogenism, increased plasma insulin levels, decreased plasma SHBG levels, and increased LH concentrations. In addition, we showed that EA could restore the estrous cyclicity and ovary morphology, reduce the body mass of PCOS rats, downregulate plasma levels of T, FAI, LH, and FINS, and upregulate plasma levels of SHBG, E2, and FSH. This animal model also exhibited a significant increase in INHB and AMH. Simultaneously, when compared with the LE group, the LE + EA group showed lower INHB and AMH levels. These findings indicated that EA not only directly reduced the expression of androgen synthesis enzymes [
Androgens activated the AR, a key transcription factor mediating androgen-induced signaling as well as a member of the nuclear receptor. AR-mediated androgen actions played an important role in follicular development. However, it acts as a double-edged sword, and in addition to the positive effects of androgen on follicular development, abnormal androgen levels, especially those found in hyperandrogenism, seriously suppress normal follicular development, and the most typical evidence comes from PCOS [
Gap junction protein (Connexin, Cx) is the main component of the gap junctions. In ovaries, Cx43, encoded by Gja1, has been found to be the main Connexin expressed in developing follicles forming the gap junctions coupling granulosa cells [
Considering the importance of GJIC for GC differentiation and oocyte growth, in addition to the important role of steroids in controlling GJIC, the current study was designed to study the effect of EA on the expression of AR and Cx43 in PCOS rat ovary. In this study, the expression of AR and Cx43 was significantly increased following letrozole administration. This was consistent with the results presented in previous studies, which demonstrate that dihydrotestosterone or androstenedione increased the expression of Cx43 in ovarian tissues
Based on the theory of traditional Chinese medicine and experimental studies, we selected acupoints with better therapeutic effects to comprehensively evaluate the therapeutic effect of EA on PCOS rats. The results confirmed the effect of EA on adjusting hormone levels and polycystic ovary morphology in PCOS rats as well as regulating ovarian local factors such as AMH, INHB, AR, or Cx43. In this work, we demonstrated for the first time the EA modulation of Cx43 in letrozole-induced PCOS rats. The limitation of our study was that the underlying mechanism of interaction between AR and Cx43 expression and the role of EA were not discussed. Therefore, further studies will be necessary to clarify the underlying mechanism(s) involved.
In conclusion, our findings indicated the effectiveness of EA in restoring the estrous cyclicity and ovary morphology and regulating circulating sex hormone levels and hyperinsulinemia in rats with letrozole-induced PCOS. Furthermore, EA normalized the letrozole-induced upregulation of AR and Cx43. Taken together, these results suggested that acupuncture may be an effective treatment method to improve the reproductive and endocrine dysfunction resulting from PCOS and could break the vicious cycle initiated by excessive androgen secretion. Guan yuan was the first acupoint to be considered in the treatment of PCOS.
Polycystic ovarian syndrome
Testosterone
Estradiol
Follicle-stimulating hormone
Luteinizing hormone
Free androgen index
Sex hormone-binding globin
Fasting serum insulin
Fasting blood glucose
Homeostasis model-insulin resistance
Anti-Müllerian hormone
Inhibin B
Androgen receptor
Connexins 43
Electroacupuncture
Enzyme-linked immunosorbent assay
Letrozole.
The datasets used and/or analyzed in the current study are available from the corresponding author upon reasonable request.
All experimental protocols used in this study were approved by the Animal Ethical Committee of Shanghai University of Chinese Traditional Medicine (Shanghai, China) and were in accordance with the ethical standards of the committee.
The authors declare that they have no conflicts of interest.
Ge Xu participated in the design of the study, supervised the animal studies, participated in animal preparation and blood flow measurements, performed the statistical analysis, and wrote the manuscript. Xi Wang, Andong Zhang, Jian-Dang Liu, and Ji Wei Feng participated in animal experiments. Yuelai Chen contributed to the design of the study and supervised all the work performed. All authors read and approved the final manuscript.
The authors thank all the individuals and institutions for their contributions to this study. This study was supported by the Shanghai Municipal Doctoral Programs Foundation (B201407).