Sympathetic remodeling may cause severe arrhythmia after myocardial infarction (MI). Thus, targeting this process may be an effective strategy for clinical prevention of arrhythmias. LianXia Formula Granule (LXFG) can effectively improve the symptoms of patients with arrhythmia after MI, and modern pharmacological studies have shown that
Myocardial infarction (MI) is one of the most serious coronary heart diseases, whose morbidity and mortality rates are gradually increasing [
Sympathetic remodeling is a key factor in induction of arrhythmia after MI [
Nerve growth factor (NGF), a member of the neurotrophic factor family, reportedly plays a crucial role in repair of sympathetic nerve injury, as well as survival and differentiation of sympathetic neurons [
Complementary and alternative medicine is commonly used in the treatment of various chronic diseases worldwide [
Traditional Chinese Medicine, characterized by multiple targets, pathways, and links, has shown promise in prevention and treatment of arrhythmia after MI [
All experimental protocols and animal handling procedures used in this study were approved by the Ethics Committee of Affiliated Hospital of Jining Medical University. Experimental work was performed in accordance with the Guide for the Animal Care and Use of Laboratory Animals published by the National Institutes of Health (NIH Publications No. 85–23, revised 1996). We made every effort to minimize animal suffering and the number of rats used in this study.
Male Sprague-Dawley rats, weighing between 200 and 220 g, were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (License No. SCXK (Beijing) 2016–0006). The animals were housed under a 12-hour light/dark cycle, with the lights on from 8 am, and allowed free access to normal rat chow and drinking water.
LXFG, produced by Beijing Kangrentang Pharmaceutical Co., Ltd., Beijing, China, consisting of 2 Chinese herbs,
SD rats were anesthetized with 1% pentobarbital sodium (40 mg/kg), by intraperitoneal injection, under intubation and mechanical ventilation using a small rodent ventilator (Alcott Biotech Co., Ltd., Shanghai, China). A standard limb lead II electrocardiogram was continuously recorded with an ECG recorder (multichannel physiological signal acquisition and processing system, Chengdu, China). Thoracotomy was performed in the left third intercostal space, and the left atrial appendage exposed then ligated directly under the original 2 mm of the left atrial appendage by a 5/0 suture. Thoracic closure was done by suturing the three layers. Successful MI model establishment was confirmed when the color of the anterior wall of left ventricle changed to a pale color, the ventricular wall motion reduced, and electrocardiograph revealed elevation of the ST segment. After surgery, the rats were administered with 400,000 units of penicillin and then placed on an electric blanket until they woke. Rats in the sham group were subjected to steps involving concentric infarction modeling, with no knots placed after threading.
Rats with successful coronary artery ligation were randomly divided into a model, metoprolol, high-dose LXFG (LXFG-H), medium-dose LXFG (LXFG-M), and low-dose LXFG (LXFG-L) groups, with 10 rats in each group. An additional sham group consisted of 8 rats that did not have actual LAD ligation. Drug dosages were administered according to the rat conversion coefficient of human clinical dose in experimental zoology [
Programmed electrical stimulation (PES) was performed as previously reported [
Blood samples were collected from the abdominal aorta of all rats, plasma was isolated, and then levels of plasma catecholamines (NE, EPI, and DA) were quantified using a commercial ELISA kit (Elabscience Biotechnology Co., Ltd., Wuhan, China), according to the manufacturer’s instructions. Absorbance was measured at 450 nm, using a microplate reader, and concentrations in the samples were calculated relative to corresponding standard curves.
We investigated TH localization and distribution via immunohistochemical staining. Briefly, the infarct border zone of the left ventricular heart tissue was collected and embedded in paraffin, and 5 µm thick sections were cut using a microtome. The sections were dewaxed, hydrated, and antigen repaired, with a 15-minute incubation at room temperature (RT) in 3% hydrogen peroxide. After blocking them with goat serum for 30 min at RT, the sections were incubated overnight with a rabbit polyclonal anti-tyrosine hydroxylase antibody (1 : 200, Abcam, UK) at 4°C and then with HRP-conjugated goat anti-rabbit IgG antibody for 30 min at RT. They were then stained with DAB solution and hematoxylin, according to the manufacturer’s instructions. The slides were dehydrated, cleared with xylene, mounted with permanent mounting medium, and photographed. Resulting images were analyzed using IPP 6.0 software, with six random fields of each slide selected, and used to calculate average optical density (AOD) of the TH-positive nerve fibers.
Samples of myocardial tissues from the infarcted border zone were prepared for protein analysis. The heart tissues samples were homogenized in RIPA lysis buffer containing a protease inhibitor cocktail. Protein concentrations were determined using the BCA kit (Beyotime, Shanghai, China), and 40
Total RNA was isolated from the infarcted border zone of rat heart using the TRIzol reagent (Invitrogen, California, USA) and subjected to complementary DNA (cDNA) synthesis using the RevertAid First Strand cDNA Synthesis Kit (Invitrogen, California, USA). qRT-PCR was performed using the SYBR Green Master Mix (Vazyme) on an ABI QuantStudio 6 PCR instrument (Applied Biosystems, New York, USA), under the following conditions: denaturation, followed by 40 cycles of 50°C for 2 min, 95°C for 10 min, 95°C for 30 s, and 60°C for 30 s). mRNA expression levels were normalized to those of GAPDH and calculated using the 2−ΔΔ
Primer sequences used in this experiment.
Primer | Forward sequence (5′-3′) | Reverse sequence (5′-3′) |
---|---|---|
TH | GAGCCTTTGACCCAGACACA | GGGCTGTCCAGTACGTCAAT |
NGF | AGACCCGCAACATCACTG | CGTGGCTGTGGTCTTATCTC |
TrKA | GACCTCAACCGTTTCCTCC | CATGCCGAAGTCTCCAATCT |
PI3K | GCAACAAGTCCTCTGCCAAA | ACGTAATAGAGGAGCTGGGC |
AKT | TTTATTGGCTACAAGGAACG | GGTGTAGTTCAGAGGCAGGT |
GAPDH | ACAGCAACAGGGTGGTGGAC | TTTGAGGGTGCAGCGAACTT |
Statistical analyses were performed using SPSS 25.0 (IBM, Armonk, USA). Quantitative data were presented as means ± standard deviations (SD). Differences among groups were determined using a one-way analysis of variance (ANOVA), whereas arrhythmia scores were examined by Kruskal–Wallis test. Statistical significance was set at
We performed PES to confirm the beneficial effect of LXFG on arrhythmia following MI. No rats experienced spontaneous VAs during the placement of the electrodes, and none of them died during the electrophysiological study. Evaluation of ventricular arrhythmia severity, by arrhythmia inducibility and arrhythmia score, revealed an induction rate of 12.5% (1/8) and an arrhythmia score of 0.75 ± 2.12 in sham group. Arrhythmia incidence and arrhythmia score in the model group were 100% (8/8) and 5.13 ± 1.81, respectively, and represented a significant increase compared with the sham group (
LXFG reduced arrhythmia susceptibility. Representative ECG of electrical stimulation, including (a) sinus rhythm, (b) nonsustained ventricular tachycardia, (c) sustained ventricular tachycardia, and (d) ventricular fibrillation. (e) Inducibility of arrhythmia after MI. (f) Inducible arrhythmia scores.
TH refers to the rate-limiting enzyme of norepinephrine synthesis and serves not only as a marker for sympathetic nerve location but also as an indicator of sympathetic activity [
Profiles of protein and mRNA expression of TH indicated significantly elevated levels in the model compared to the sham group (
Effect of LXFG on sympathetic remodeling in the infarcted border zone after MI. (a) Western blots for TH and GAPDH in heart. (b) Profiles of relative protein expression of TH in each group (
In the immunohistochemical staining, the TH-positive nerve fibers are marked brown, located between the myofibrils and arranged longitudinally. There were few TH-positive nerve fibers in the sham group, which were consistent with the direction of myocardial cells. In the model group, the expression of TH was significantly increased, and the morphology was thick and disorderly, and some of them were aggregated into bundles. Immunohistochemical staining analyses validated cardiac sympathetic remodeling in model rats, while LXFG treatment reversed this effect (Figures
We evaluated peripheral sympathetic activity by determining levels of plasma catecholamines, including norepinephrine (NE), epinephrine (EPI), and dopamine (DA). Results revealed significant upregulation of these in the model, relative to the sham group (
Effect of LXFG on plasma catecholamines.
Levels of NGF, TrKA, PI3K, and AKT mRNAs were significantly upregulated in the model (
Profiles of mRNA expression of the NGF/TrKA/PI3K/AKT signaling pathway in the infarcted border zone in rats in each group (
To clarify the action mechanism of LXFG, we used western blot to analyze expression levels of proteins in the NGF/TrKA/PI3K/AKT signaling pathway. Since phosphorylated proteins can regulate intracellular signal transduction, whereas P-Bad is a downstream factor of the PI3K/AKT signaling pathway mediating survival, we specifically detected P-PI3K, P-AKT, and P-Bad proteins. Western blots revealed significant upregulation of NGF, TrKA, P-PI3K, P-AKT, and P-Bad in the model, relative to the sham group (
Expression profiles of key proteins in the NGF/TrKA/PI3K/AKT signaling pathway in the infarcted border zone in rats in each group (
Our results revealed significant upregulation of the NGF/TrKA/PI3K/AKT signaling pathway after MI. Moreover, LXFG treatment suppressed arrhythmia, alleviated sympathetic remodeling in the infarcted border zone, and suppressed overactivation of the NGF/TrKA/PI3K/AKT signaling pathway after MI.
MI induction initiates a dynamic evolution process of degeneration, necrosis, regeneration, and remodeling of cardiac sympathetic nerve. Sympathetic remodeling, a repair response to ischemic injury, has been hypothesized to be a protective mechanism [
Results of the present study revealed significantly higher incidence of arrhythmia and arrhythmia scores in the model group, relative to the sham group. Moreover, we observed significantly elevated expression of TH proteins and mRNAs in the infarcted border zone, while TH-positive nerve fibers were disordered, indicating that sympathetic remodeling increases the susceptibility to arrhythmia after MI. However, incidence of arrhythmia after MI exhibited a dose-dependent decline after 30 days of LXFG treatment. In addition, LXFG treatment significantly alleviated sympathetic remodeling, indicating a harmonious distribution of the sympathetic nerve. Overall, these findings suggested that LXFG may be a suitable and effective alternative medicine for treating arrhythmia following MI.
To elucidate the molecular mechanisms underlying LXFG’s attenuation of sympathetic remodeling in rats, we targeted the NGF/TrKA/PI3K/AKT signaling pathway. Previous studies have shown that NGF plays a pivotal role in regulating neuronal survival, plasticity, and disease [
In this study, we successfully established a MI model by ligating rats’ left anterior descending coronary artery. Western blots and qRT-PCR results revealed significant upregulation of key proteins and mRNAs in the NGF/TrKA/PI3K/AKT signaling pathway as well as P-BAD in the model group. These results suggested that sympathetic remodeling in the model group might be associated with increased activation of the NGF/TrKA/PI3K/AKT signaling pathway, which mediates excessive sympathetic survival in the infarcted border zone. LXFG’s ability to downregulate expression of key molecular proteins and mRNA of the NGF/TrKA/PI3K/AKT signaling pathway indicated that this drug has inhibitory effects on the pathway (Figure
LianXia Formula Granule alleviates arrhythmia in rats with myocardial infarction via the NGF/TrKA/PI3K/AKT signaling pathway. LianXia Formula Granule treatment downregulated the expression of key molecular proteins and mRNA of NGF/TrKA/PI3K/AKT signaling pathway as well as P-Bad; attenuated sympathetic remodeling in the infarcted border zone of rat cardiac tissues. LXFG, LianXia Formula Granule; NGF, nerve growth factor; TrKA, tyrosine kinase receptor A; PI3K, phosphatidylinositol 3-kinase; AKT, protein kinase B.
TCM has been used, for more than 2,000 years, to treat cardiovascular diseases as well as for prevention and treatment of myocardial infarction diseases [
This study had some limitations. Firstly, we did not consider inhibitors of the NGF/TrKA/PI3K/AKT signaling pathway. Secondly, we did not test LXFG’s effect using cell experiments. Therefore, future studies, using a combination of a variety of inhibitors and detection methods, are needed to validate exact regulatory targets and underlying mechanisms of LXFG.
In summary, LXFG reduces arrhythmia and attenuates sympathetic remodeling after MI, by suppressing expressions genes and proteins in the NGF/TrKA/PI3K/AKT signaling pathway. High dose of LXFG has a more significant effect over low dose and medium dose. Our findings have critical clinical implications and provide novel insights to guide development of therapies for prevention and treatment of arrhythmia following MI.
The data used to support the findings of this study are available from the corresponding author upon reasonable request.
The authors declare that they have no conflicts of interest regarding the publication of this paper.
Sai-Sai Li and Nan Kang contributed equally to this paper.
This research was supported by the Shandong Provincial Natural Science Foundation (no. ZR2017BH063) and the National Natural Science Foundation of China (no. 81960852).