Yu-Ping-Feng (YPF) formula is a classical prescription used for enhancing the body’s immunity function in traditional Chinese medicine (TCM). In clinical practice, the YPF formula has been reported to exhibit antilung cancer and immunomodulatory effect. However, the relationship between them remains unclear. The present study aimed to investigate the antilung cancer effect of the YPF formula and its immune-related mechanisms. The C57BL/6 tumor-bearing mice model was established and randomly divided into the YPF group and the control group. Tumor volume, spleen weight, and survival in both groups were measured and evaluated during 28 days of consecutive intervention. Flow cytometry was used to detect the proportion of immune cell subsets. Myeloid-derived suppressor cells (MDSCs) were induced in vitro from bone marrow cells. After intervention by the YPF formula, CCK-8 and flow cytometry analyses were performed to detect proliferation and apoptosis of MDSCs. A coculture system containing T cells and MDSCs was established to further study the role of MDSCs in the regulation of T-cell subsets proportion by the YPF formula. The expressions of MDSCs-related genes and proteins were detected by RT-PCR and Western blotting. The results showed the YPF formula inhibited tumor growth, reduced spleen weight, and prolonged the survival of mice. Besides, the proportions of MDSCs subsets and Regulatory
Lung cancer is the leading cause of cancer morbidity and mortality worldwide [
MDSCs, as one of the most important immune suppressive cells in the TME, possess complex phenotypes. In mice, the phenotype of MDSCs is Gr-1+CD11b+. According to the difference in epitopes, MDSCs can be further divided into monocytic MDSCs (Gr-1+CD11b+Ly6G−Ly6Chi) and granulocytic MDSCs (Gr-1+CD11b+Ly6G+Ly6Clo) [
The YPF formula is a classical TCM prescription that was invented by
All granules for the in vivo experiments were purchased from Jiangyin Tianjiang Pharmaceutical Co. Ltd. The clinical drug dose and medicinal part of each herb are listed in Table
The composition of the YPF formula.
Herb | Latin scientific name | Officinal part | Dosage (g) |
---|---|---|---|
Astragali radix ( | Root | 18 | |
Atractylodis Macrocephalae Rhizoma ( | Rhizome | 18 | |
Saposhnikoviae Radix ( | Root | 9 |
Lyophilized powder of the YPF formula was applied in the in vitro study. The raw herbs of Astragali Radix (Huang-Qi), Atractylodis Macrocephalae Rhizoma (Bai-Zhu), and Saposhnikoviae Radix (Fang-Feng) were purchased from the pharmacy of Shanghai Municipal Hospital of TCM. The quality of the herbs was identified by Professor Haiqing Zhu. The specific drug dose of the YPF formula was 18 g:18 g:9 g (Huang-Qi: Bai-Zhu: Fang-Feng). The extract of the YPF formula was diluted 10 times in distilled water and heated for three hours under continuous stirring at 100°C. The process was repeated twice and the extract was centrifuged at 1500 g. The supernatant was collected and evaporated at 70°C until the semisolid was formed. Triethanolamine was used as a neutralizer to regulate the pH value between 6 and 8 of the lyophilized powder. The mixture concentration was diluted to 1 g/mL by DMEM and stored at −20°C until use. A sample of the YPF formula was kept in our laboratory for future reference.
The DMEM medium, PBS medium, and 10% fetal bovine serum were purchased from Gibco Life Technologies (Grand Island, NY, USA). The tumor dissociation kit and spleen dissociation kit were obtained from Miltenyi Biotec (San Diego, CA, USA). Anti-mouse PerCP/Cy5.5 CD3, anti-mouse FITC CD4, anti-mouse PE CD8, anti-mouse APC CD25, anti-mouse FITC Gr-1, anti-mouse PE CD11b, anti-mouse PerCP/Cy5.5 Ly6c, and anti-mouse APC Ly6g were all purchased from Biolegend (San Diego, CA, USA). 5%BSA, paraformaldehyde, electrophoresis solution, transfer solution, CCK-8 kit, RIPA were all provided by Beyotime Biotech (Beijing, China). The SDS-PAGs (Sodium Dodecyl Sulfate-Polyacrylamide Gels) were bought from Dakewe Biotech (Shenzhen, China). RT-PCR primers were designed and provided by Sangon Biotech (Shanghai, China). Trizol reagent, Tween-20, and 20 × TBS buffer were obtained from Thermo Scientific (Rockford, IL). Antibodies for Western blot were all purchased from Cell Signaling Technology (MA, USA). An ECL Kit was provided by Tanon Biotech (Shanghai, China).
LLC (Lewis lung cancer) cells were purchased from the cell bank of Shanghai Institute of Life Sciences, Chinese Academy of Sciences (Shanghai, China). The LLC cells were cultured in the DMEM medium, supplemented with 100U/L penicillin, 0.1 mg/mL streptomycin, and 10% fetal bovine serum. Cells were maintained at 37°C in a cell incubator with an atmosphere of 5% CO2.
Five-week-old C57BL/6 mice (male, 18–22 g) were purchased from Slack Experimental Animals Co. Ltd. of the Chinese Academy of Sciences (Shanghai, China). Mice were maintained in the Animal Experimental Center of Shanghai Municipal Hospital of TCM. The environment was strictly controlled at the temperature of 20–24°C, the humidity of 50%–60%, as well as the 12 h/12 h light-dark cycle. Food and water were free to access for mice and provided by the animal experiment center. Ten mice were randomly divided into the control group and the YPF group (five per group). Logarithmic growth LLC cells were digested and counted. Each mouse was subcutaneously inoculated with 1 × 106 LLC cells into the right flanks. 24 hours after inoculation, mice in the YPF group were treated by oral gavage with 200
For spleen single-cell suspension preparation, we minced the spleen tissues by a scissor and put them into a C tube of gentle MACS. Then, the corresponding enzyme solution was prepared and added. After ground by the gentleMACS machine and filtered through a 30
After sacrificing the mice by cervical dislocation, the 1640 medium was used to rinse the bone marrow cavity of the tibia and femur to obtain the bone marrow. The bone marrow sample was filtered through a 45
T lymphocytes were isolated by the method of Ficoll density gradient centrifugation. The spleen was thoroughly minced and ground on a 100-mesh filter. The spleen was washed with PBS and the cell suspension was collected. Ficoll was then added to the cell suspension in a 1 : 1 ratio and centrifuged at 2000 rpm for 20 minutes. The T lymphocyte was aspirated in the narrow zone at the junction of the two layers, and PBS was added, centrifuged at 4°C (2000 rpm for 10 min), and resuspended. Finally, the MDSCs and T lymphocytes were mixed in a 1 : 1 ratio (3 × 105) to establish a coculture system.
Cell apoptosis was detected using the Annexin V-FITC/PI Apoptosis Detection Kit according to the manufacturer’s protocol. About 1 × 105 bone marrow cells were collected and centrifuged at 300 g for 5 minutes. 5
RT-PCR assay was performed to detect STAT3, iNOS, and Arg-1 mRNA expression levels in vivo and in vitro. TRIzol reagent was used to extract the total RNA according to the manufacturer’s instructions. Reverse transcription was carried out to acquire cDNA using a High-Capacity cDNA Reverse Transcription Kit (Takara Bio, China). SYBR green real-time PCR super mix was used for PCR amplification. All genes were amplified under the standard PCR conditions with 37 cycles, the annealing step lasted for 20 seconds at 60°C, and extension step lasted for 60 seconds at 72°C. The primer sequences of the genes were designed and displayed as followed: iNOS: F: AGATTCCGTCCATCAAGT; R: CAGTCCTCGGGTAGTCAA; Arg-1: F: AGTCAGTCCCTGGCTTAT; R: AAGACAGCAGAGGAGGTG; STAT3: F: CCAGCAACCTGACTTTCG; R: TTCAGACCCGCCAACAAA; GAPDH: GTGGAGATTGTTGCCATCAACGA; R: CCCATTCTCGGCCTTGACTGT. The expression level of the GAPDH gene served as endogenous control, and the 2−△△Ct value was used to qualify the relative gene expression levels.
The samples were completely lysed and centrifuged, and the supernatant was collected for quantitative protein analysis. About 50
SPSS 25.0 for Windows (SPSS Inc, Chicago, IL, USA) and GraphPad Prism 8.0 (GraphPad Software Inc, California, USA) were used for statistical analysis and result representation. All continuous data were expressed as the mean ± standard deviation. Comparisons between the two groups were performed by Student’s
To explore the antitumor effect of the YPF formula, LLC cells (1 × 106) were inoculated subcutaneously into the right flanks of C57BL/6 mice (
The YPF formula suppressed LLC xenograft tumor growth and prolonged the survival of tumor-bearing mice. All values are expressed as mean ± SD,
Since the potential immunomodulatory effects exhibited by the YPF formula, we prepared the single-cell suspensions of the tumor tissues and spleens from tumor-bearing mice to further explore the specific immunomodulatory mechanism. Results showed that, compared with the control group, the proportions of both granulocyte-like and monocyte-like MDSCs in mice spleen and tumor tissue were significantly decreased in the YPF group. For T-cell subsets, the proportions of CD4+T and CD8+T in the YPF group increased, whereas the proportion of Treg decreased significantly in the YPF group, as shown in Figures
Effects of the YPF formula on the proportion of immune cells in the spleen. (a) The proportion of MDSCs (Gr-1+CD11b+). (b) The proportion of monocytic MDSCs (Gr-1+CD11b+Ly6G−Ly6Chi). (c) The proportion of granulocytic MDSCs (Gr-1+CD11b+Ly6G+Ly6Clo). (d) The proportion of CD3+CD4+T lymphocytes. (e) The proportion of CD3+CD8+T lymphocytes. (f) The proportion of CD4+CD25+T lymphocytes (Treg).
Effects of the YPF formula on the proportion of immune cells in tumor tissues. (a) The proportion of MDSCs (Gr-1+ CD11b+). (b) The proportion of CD3+CD4+T lymphocytes. (c) The proportion of CD3+CD8+T lymphocytes. (d) The proportion of CD4+CD25+T lymphocytes (Treg).
For in vitro experiment, the concentration of the YPF formula was set as 7 mg/mL according to the IC50 value determined in our previous research. The in vitro experiments also confirmed that, after the YPF formula’s intervention, the total MDSCs and its subsets in the YPF group were significantly reduced. As shown in Figure
Effects of the YPF formula on proliferation and apoptosis of MDSCs and its subsets. (a) Proportion of MDSCs (Gr-1+ CD11b+). (b) The proportion of monocytic MDSCs (Gr-1+CD11b+Ly6G−Ly6Chi). (c) The proportion of granulocytic MDSCs (Gr-1+CD11b+Ly6G+Ly6Clo). (d) The proliferation of MDSCs was detected by the CCK-8 assay. (e) Apoptotic cells were routinely detected by the Annexin V/PI staining method. The proportion of apoptotic cells is shown in the lower right quadrant, and the cells shown in the upper right quadrant are necrotic cells or cells with secondary necrosis after apoptosis. The concentration of the YPF formula was 0 mg/mL for the control group and 7 mg/mL for the YPF group.
To further investigate the role of MDSCs in the regulation of T-cell subsets proportion by the YPF formula, we established a coculture system of T lymphocytes and MDSCs. As shown in Figure
The YPF formula regulated the proportion of T-cell subsets in the coculture system by inhibiting MDSCs. (a) Effect of the YPF formula on the proportion of T-cell subsets. “
To verify the effect of the YPF formula on MDSCs related immunosuppressive genes, the RT-PCR assay was conducted. Results showed that, after intervention by the YPF formula, the levels of Arg-1, iNOS, and STAT3 were significantly decreased in vivo and in vitro. These genes were considered to be closely involved in the proliferation and activation of MDSCs.
Western blot analysis confirmed that the expression levels of phospho-AKT, phospho-MEK, phospho-ERK, and phospho-STAT3 protein in the YPF group were significantly decreased. It indicated that the YPF formula could downregulate the expression levels of MDSCs proliferation-related proteins, as shown in Figures
The YPF formula downregulated the expression levels of MDSCs immunosuppressive-related genes and proliferation-related proteins in vivo. (a) RT-PCR was used to detect the expression levels of STAT3, iNOS, and Arg-1 mRNA in the tumor tissues. (b) Western blot was used to investigate the expression of MDSCs proliferation-related proteins p-STAT3, p-AKT, p-MEK, and p-ERK in the tumor tissues. All data were expressed as the mean ± SD from at least three independent experiments.
The YPF formula downregulated the expression levels of MDSCs immunosuppressive-related genes and proliferation-related proteins in vitro. (a) RT-PCR was used to detect the expression levels of STAT3, iNOS, and Arg-1 mRNA in vitro. (b) Western blot was used to investigate the expression of MDSCs proliferation-related proteins p-STAT3, p-AKT, p-MEK, and p-ERK in vitro. All data were expressed as the mean ± SD from at least three independent experiments.
Lung cancer is one of the most common malignancies in China and even worldwide, which is becoming the main killer of human health, due to its high global incidence and mortality. In recent years, due to the promotion of smoking cessation education, early screening work, and the progress of treatment fields (such as targeted therapy, immunotherapy, etc.), the mortality rate of lung cancer has shown a rapid trend of decline [
The tumor microenvironment is a unique complex network environment in the process of tumor progression, which is not only the site of tumor cells but also including a series of cells that contribute to the immunosuppressive properties of the tumor environment, such as MDSCs. MDSCs, as precursors of dendritic cells, macrophages, and granulocytes, are heterogeneous cell populations derived from bone marrow progenitors and immature myelocytes [
YPF formula, as a classic prescription of TCM, was first seen in Danxi’s experiential therapy in Ming Dynasty. Pharmacological studies indicated that the YPF formula could play an immunomodulatory role by enhancing the activation, proliferation, and phagocytosis of macrophages. Besides, it could also regulate the anti-inflammatory activity of T lymphocytes and enhance the phagocytic activity of NK cells [
In the present study, it was found that the YPF formula could inhibit tumor growth in Lewis lung carcinoma tumor-bearing mice and prolong survival. After intervention by the YPF formula, it also brought about the changes in the downregulation of the proportion of MDSCs and Treg cells, as well as the upregulation of CD4+
Previous researches have shown that MDSCs exerted the immunosuppression effect in multiple ways. First of all, MDSCs suppressed the proliferation and activation of CD4+
With the deepening of MDSCs research, several signaling pathways were found involved in the regulation of MDSCs in recent years, such as the JAK/STAT3 pathway, NF-
Based on the unique efficacy of the YPF formula in antilung cancer and limited drug resources, how to extract the maximum active ingredients and improve the utilization rate of the drug in the preparation of the YPF formula is also an urgent problem to be solved. It has been reported that some pretreatment methods, such as pre-soaking, liquid ammonia pretreatment, and hydrogen peroxide pre-soaking, have positive significance in stabilizing the chemical composition of drugs and maximizing the yield of drugs, which contributed to ensuring the clinical efficacy [
To sum up, our study demonstrated that remodeling of the tumor microenvironment was one of the important mechanisms of the YPF formula’s antilung cancer effect. The effect was manifested specifically in upregulating the positive immune cells and downregulating the negative immune cells. Among them, MDSCs played a critical role in the regulation process. By inhibiting proliferation and promoting apoptosis of MDSCs, the YPF formula reduced the levels of MDSCs in the tumor microenvironment. As a result, the oxidative stress was reduced and the negative regulatory effect on the proliferation of positive immune cells was removed, thus contributing to remodeling the tumor microenvironment.
The YPF formula can suppress subcutaneous xenograft growth of Lewis lung carcinoma tumor-bearing mice and prolong survival. Besides, the negative immune cells (MDSCs and its subsets, Treg) decrease, and the positive immune cells (CD4+
Yu-Ping-Feng
Traditional Chinese medicine
Myeloid-derived suppressor cells
Tumor microenvironment
Regulatory T
Acute myeloid leukemia
Tumor-associated macrophages
High performance liquid chromatography
Natural killer
Lewis lung cancer
Propidium iodide
Polyvinylidene fluoride
Sodium dodecyl sulfate-polyacrylamide gel.
The data used to support the findings of this study are included within the supplementary materials.
The authors declare that they have no conflicts of interest.
Jianchun Wu and Yan Li designed the study. Yuli Wang and Ningyang Sun conceived and performed the experiments. Yingbin Luo and Yuan Fang analyzed data and drafted the original draft. Zhihong Fang, Jianhui Tian, and Yongchun Yu reviewed and revised the manuscript. All authors have read and approved the final paper. Yuli Wang and Ningyang Sun contributed equally to this work.
This work was supported by the National Natural Foundation of China (81673947 and 81973795), a Three-Year-Action Plan (2018–2020) of Shanghai further accelerating the development of Traditional Chinese Medicine (ZY (2018–2020) CCCX-4001-01), Outstanding Youth Project of Shanghai Municipal Health Committee (2017YQ049), Research Project of Shanghai Municipal Commission of Health and Family Planning (201740059), and Shanghai Pujiang Program (2020PJD057).
The granules of the YPF formula analyzed by HPLC, the purity of induced MDSCs cell populations determined by flow cytometry, the primary antibodies, dilutions, and source for Western blot are shown in the supplementary materials.