Polysaccharide of
In the brooding stage of geese, due to the imperfection of immune function, goslings are vulnerable to various pathogenic microorganisms, leading to the occurrence of various intestinal diseases and seriously affecting the healthy development of the goslings. However, antibiotics, hormones, and other chemical drugs very easily cause drug residue in poultry products. Therefore, the development of antibiotic replacement products, which can effectively improve the immunity of goslings without residues and toxic and side effects, has become one of the hot issues of concern. Polysaccharide of
The intestinal mucosal immune system is mainly composed of mucosa-associated lymphoid tissue (MALT), including mesenteric lymph nodes, aggregate lymph nodules, and lymphocytes dispersed in the intestinal lamina propria and intestinal epithelium. It plays an important role in maintaining intestinal flora balance and intestinal barrier function and repairing intestinal mucosal epithelium [
The intestinal microbiota is a biological barrier, forming an interdependent and interacting microecosystem with the host. The composition and ratio of various microbial species in the intestinal tract are generally relatively stable, and the bacterial species have a restrictive and interdependent relationship. The influence of intestinal flora on the immune function of intestinal mucosa is double-sided [
Traditional Chinese medicine polysaccharides are food-borne substances that can directly enter the body’s digestive system, and some of them can be directly decomposed and used as nutrients by gastrointestinal microorganisms. Therefore, traditional Chinese medicine polysaccharides must be closely related to intestinal flora. Polysaccharide of
One-day-old goslings (
PAMK (purity 70%, Lot: 20180608) was purchased from Tianyuan (Xi’an, China) and was sent to Shanghai Sanqing Biotechnology Co., Ltd. for molecular weight, monosaccharide composition, and structure analysis. GPC-RI-MALS instrument (detector: RI, MALS; mobile phase: NaNO3; flow rate: 0.4 mL/min; column temperature: 60°C; analytical column model: OHpak SB-805 HQ, OHpak SB-804 HQ, OHpak SB-803 HQ) was used for molecular weight determination. Weigh 10 mg of the sample, add TFA, and perform acidolysis at 110°C overnight; evaporate the mixture after acidolysis in vacuo, add 1 mL of sterile water to dissolve it thoroughly, centrifuge at 12000 rpm for 10 minutes, and take the supernatant. Using ICS (detector: DAD; mobile phase: NaOH/NaAc) to determine the composition of monosaccharides in PAMK, we found that the contents of Fuc, Gal, Glc, Xyl, and Fru were 0.98%, 0.40%, 88.67%, 4.47%, and 5.47%, respectively. In addition, the structure of PAMK was analyzed using an infrared spectrometer (VERTEX 70).
PAMK was diluted with ddH2O and sprayed on the feed according to the concentration of 400 mg·kg−1. LPS (
Two hundred goslings (1-day-old, with half males and half females) were randomly divided into four groups (
Experiment grouping and treatment.
Group | PAMK (mg/kg) | LPS (mg/kg·BW) |
---|---|---|
FBC1 | — | — |
FBP | 400 | — |
FBL | — | 2 |
FBPL | 400 | 2 |
The duodenum, jejunum, and ileum were fixed in paraffin. The paraffin-fixed blocks were serially sectioned into 5 to 6
Venous blood was collected to separate the serum. The levels of endotoxin in serum were measured using endotoxin detection kit according to the manufacturer’s instruction. The levels of CRP, IL-1
Paraffin sections were incubated with IgA primary antibody (Bethyl, Lot: A30-103P), operated according to the immunohistochemistry kit (purchased from DAKO ChemMate EnVision, Lot: K5007), and observed using a microscope (Nikon, ECLIPSE E100). Five 400-fold magnification fields were selected for each section to calculate the number of positive IgA-secreting cells.
Specific primers matching reverse-transcribed mRNA were designed (Table
The primers and amplification parameters of target genes.
Gene | Primer sequence (5′ to 3′) | |
---|---|---|
TLR4 | F: TTGTGTGCTGAAGGTCCAAG | R: TCCTCAGTTTCCTGGGTCTG |
Occludin | F: TCTTCCACATCAAGCGCATG | R: GGTCGCTTTGGATGTTGGTT |
ZO-1 | F: CAAAGGTGAAGTGTTCCGGG | R: CTCCTCCTGCTGTCTTTGGA |
IL-1 | F: ACGGTGTGGGGACATTCATC | R: AGGCGAAGCTTCTTCTGTGG |
IL-2 | F: TCATCTCGAGCTCTACACACCAA | R: TGCATTCACTTCCGGTGTGAT |
IL-4 | F: GGCATCTACCTCAACTTGCT | R: CTCTTTCGCTACTCGTTGGA |
IL-6 | F: ACGATAAGGCAGATGGTGAT | R: TCCAGGTCTTATCCGACTTC |
IL-10 | F: ATCATGACATGGACCCGGTA | R: ATTGCTCCATGACAGTTGCT |
IFN- | F: CCAGATTGTTTCCCTGTACTTG | R: CATCAGAAAGGGTGTCTCTCA |
TGF- | F: CATCACAGAGACAGGAACCTT | R: CTTTCACATCACCACTGGAA |
IgA | F: GTCACCGTCACCTGGACTACA | R: ACCGATGGTCTCCTTCACATC |
IgG | F: ATCACGTCAAGGGATGCCCG | R: ACCAGGCACCTCAGTTTGG |
IgM | F: GCATCAGCGTCACCGAAAGC | R: TCCGCACTCCATCCTCTTGC |
F: GCACCCAGCACGATGAAAAT | R: GACAATGGAGGGTCCGGATT |
The gosling excrement was collected and sent to Shenzhen Hengchuang Gene Technology Co., Ltd. for total DNA extraction, PCR amplification, and 16S rDNA sequencing. Eight replicates were set for each group. After the data analysis was performed, three samples with poor reproducibility were removed. The target DNA obtained by PCR amplification was amplified by the 16S rDNA V4 region, and the raw data was obtained by Illumina HiSeq 2500 PE250 sequencing platform. After the data was split, PE reads were spliced, tags went to the chimera sequence, etc., some low-quality data was removed and the final valid data was obtained. OTU clustering and species annotation, alpha diversity, beta diversity, and statistical analysis of differences between groups were performed on the data.
The results were expressed as means ± SD. All the qPCR reactions were performed in triplicate, and the relative levels were measured in terms of threshold cycle value (Ct) and were normalized using equation 2−∆∆Ct. Statistical analysis of all data was performed using SPSS (version 16, SPSS Inc.). The statistical significance (
Figure
(a) Infrared spectrum results of PAMK. (b) Effects of PAMK on the morphology of duodenum in LPS-treated gosling. (c) Effects of PAMK on the morphology of jejunum in LPS-treated gosling. (d) Effects of PAMK on the morphology of ileum in LPS-treated gosling. (e) Effects of PAMK on the V/C value in LPS-treated gosling: (A) V/C value of the duodenum; (B) V/C value of the jejunum; (C) V/C value of the ileum. Letter a represents small intestine villi, b represents the muscular layer, and black arrows represent goblet cells (100×). Different letters indicate
The results in Figure
Figure
As shown in Figure
By calculating the villus length/crypt depth (V/C) values of the duodenum, jejunum, and ileum (Figure
The results showed that (Figure
Effects of PAMK on the serum inflammation index of LPS-treated gosling. (a) The serum endotoxin level. (b) The serum CRP level. (c) The serum IL-1
The results of duodenum immunohistochemistry showed (Figures
(a) Effects of PAMK on IgA-secreting cells in small intestine of LPS-treated gosling. Black arrows indicate IgA-secreting cells (200×). (b) Effects of PAMK on number of IgA-secreting cells in small intestine of LPS-treated gosling: (A) number of IgA-secreting cells in the duodenum; (B) number of IgA-secreting cells in the jejunum; (C) number of IgA-secreting cells in the ileum. Different letters indicate
The results of jejunal immunohistochemistry showed (Figures
The results of ileal immunohistochemical staining showed (Figures
In summary, LPS caused an increase in IgA-secreting cells in the duodenum, jejunum, and ileum, promoted small intestine to secrete sIgA, and enhanced the immune barrier function of intestinal mucosal immunity. However, whether this is due to the compensatory increase of IgA secretory cells caused by the inflammation of LPS still needs further discussion. In addition, PAMK has the effect of increasing the number of IgA-secreting cells in the duodenum and jejunum and also inhibits the significant increase in the number of IgA-secreting cells in the small intestine caused by LPS. Therefore, PAMK is a dynamic and stable regulation of intestinal mucosal immune function.
The relative mRNA expression of IgA in the gosling small intestine showed (Figure
(a) Effects of PAMK on the immunoglobulin mRNA expression in the small intestine of LPS-treated gosling: (A) relative mRNA expression of IgA; (B) relative mRNA expression of IgG; (C) relative mRNA expression of IgM. (b) Effects of PAMK on the cytokine mRNA expression in the small intestine of LPS-treated gosling: (A) relative mRNA expression of CRP; (B) relative mRNA expression of IL-1
The relative mRNA expression of IgG in the goslings small intestine tissue showed (Figure
The relative mRNA expression of IgM in the small intestine tissue of goslings showed (Figure
The relative mRNA expression of CRP in the small intestine tissues of goslings showed (Figure
The relative mRNA expression of IL-1
The relative mRNA expression of IL-4 in the small intestine tissues of goslings showed (Figure
The relative mRNA expression of IL-6 in the small intestine tissues of goslings showed (Figure
The relative mRNA expression of IL-10 in the small intestine tissues of goslings showed (Figure
The relative mRNA expression of IFN-
The results showed (Figure
The results showed (Figures
As shown in Figure
(a) The sequence composition of samples at each taxonomic level. Sequence number percent indicates the ratio of the number of sequences annotated to this level to the total annotation data. (b) Annotation results of grouping relative abundance (species). Relative abundance is the ratio of the number of bacteria that are annotated to species to the total number of bacteria. (c) Species abundance cluster. (d) Heatmap of beta diversity index. The number in the square is the coefficient of dissimilarity between two pairs of samples. The smaller the coefficient of difference is, the smaller the difference of species diversity is. In the same box, the values of upper, middle, and lower represent weighted UniFrac, unweighted UniFrac, and Bray–Curtis distance.
Based on the species annotation and abundance information of all samples at the genus level, the abundance information of the genus level in each sample was selected to draw a histogram, and the difference in abundance levels between the groups was analyzed. The results (Figure
In order to find the aggregation law of species or samples, the abundance information of the genus level in each sample was selected to draw a heatmap and clustered from the classification information and the difference between the samples. The results (Figure
Alpha diversity is an analysis of the richness and uniformity of species composition in a sample, usually assessed using indicators such as observed species, PD whole tree, Shannon, and Chao1. The more complex the diversity of a sample, the higher the index. The results showed (Figure
(a) Alpha diversity index: (A) Shannon; (B) Chao1; (C) observed species; (D) PD whole tree. Different letters indicate
Beta diversity was used to compare the microbial community composition between different samples. Bray–Curtis, weighted UniFrac, and unweighted UniFrac distance were used to estimate the microbial community structure differences between different samples based on the OTU abundance information of the samples. Beta diversity is mainly used to measure the coefficient of dissimilarity between two samples. The smaller the value, the smaller the difference in microbial community composition between the two samples. Figure
Principal Component Analysis (PCA) is a method of dimensionality reduction of multidimensional data to extract the most important elements and structures in the data. Principal Coordinate Analysis (PCoA) is a similar dimension reduction method to PCA, extracting the most important elements and structures from multidimensional data. The results show (Figure
The ANOSIM (analysis of similarities) is a nonparametric test used to test whether the difference between the groups is significantly greater than the difference within the group to determine whether the test is meaningful. The results of the ANOSIM mainly include the
Differences between groups (ANOSIM).
Group | ||
---|---|---|
FBPL-FBL | 0.84 | 0.006 |
FBP-FBL | 0.792 | 0.008 |
FBC1-FBL | 0.764 | 0.009 |
FBC1-FBPL | 0.292 | 0.072 |
FBP-FBC1 | 0.184 | 0.109 |
FBP-FBPL | 0.132 | 0.126 |
Based on Fisher’s exact test MetaStat software, the statistical analysis of species differences was performed. The
Abundance of
Group | FBC1 | FBL | FBP | FBPL |
---|---|---|---|---|
62.25 | 3.97 | 61.71 | 67.77 |
LPS is the main component of the cell wall of Gram-negative bacteria and plays an important role in mediating the intestinal inflammatory response of inflammatory bowel disease, so it is often used to construct enteritis models for more in-depth scientific research. Research points out that the mechanism of LPS-induced damage to the body has the following two types [
The intestine not only has the functions of digestion, absorption, and secretion, but also has an important barrier function and is the main part of the body’s mucosal immune system. The mucosal barrier of the body includes mechanical barrier, chemical barrier, immune barrier, and biological barrier [
The normality of the morphological structure of the small intestine mucosa is directly related to the function of the intestinal barrier and reflects the level of intestinal mucosal immunity. Observing the small intestine of goslings in this study, we found that LPS has obvious damage to the small intestine of healthy goslings. The overall performance is the loss of villi epithelial damage, cellular vacuolation, increased compensation for goblet cells, loose tissue, and obvious inflammation. Goslings show the characteristics of enteritis, and the mechanical barrier of the small intestine is damaged. We found that LPS has the most significant damage to the duodenum and less damage to the jejunum segment, which may be directly related to the high expression of TLR4 in the duodenal tissue of goslings. PAMK has a good repair effect on the damaged small intestine mucosa, of which the repair of the ileum segment is the most significant, and can promote the development of the ileum villi of healthy goslings. Therefore, it can be concluded that PAMK has a certain promoting effect on the development of the small intestine. It can effectively alleviate tissue inflammation and mechanical barrier damage caused by LPS. This effect is most obvious in the ileal segment, and the mechanism of action can be further explored. Intestinal epithelial cells can maintain the permeability of small intestinal epithelium by controlling the opening and closing of tight junctions. Therefore, tight junctions have an important role in preventing pathogenic bacteria and harmful antigens from entering the intestinal mucosa lamina propria and are the structural basis for maintaining the mechanical barrier function of the intestinal epithelium [
This study found that PAMK can not only promote the expression of occludin and ZO-1 in the duodenum, jejunum, and ileum of goslings, but also alleviate the inhibitory effect of LPS on occludin and ZO-1, so that the expression of occludin and ZO-1 in each small intestine segment is close to or higher than that of normal goslings, which has a protective effect on the tight connection of goslings. In summary, PAMK can alleviate the inflammatory response of LPS, maintain the normal intestinal mechanical barrier function, and ultimately protect the immune function of goose intestinal mucosa. The report pointed out that PAMK can cause the increase of cellular polyamine content, stimulate the migration of intestinal epithelial cells, and accelerate intestinal injury and healing, which may be the mechanism of PAMK protection and repair of mechanical barriers [
Plasma cells differentiated from intestinal B lymphocytes undergo a process of polymorphism change and class conversion at the center of intestinal lymphocytic vesicles and then convert Ig type cells into mucosa-related IgA-secreting cells. Therefore, the content of sIgA in the intestine is directly related to the number and secretion capacity of IgA-secreting cells, and its secretion is also regulated by the level of receptor humoral immunity. Intestinal sIgA is an important marker of intestinal acquired immunity, which can prevent bacteria from adhering to the surface of intestinal epithelial cells, neutralize toxins, and viruses and have an immunoprotective effect [
The stability of the biological barrier function is not the absolute increase or decrease of the bacterial flora, but the mutual inhibition of different bacterial flora to achieve the relative balance of various intestinal bacteria, thereby effectively maintaining the microecological balance of the intestine and promoting the mucosal immune system stable. The two most important ways for polysaccharides of traditional Chinese medicine (TCM) to play a role are as follows: first, polysaccharides can be directly absorbed by the intestine into the blood circulation without being degraded or degraded; second, the sugar fragments produced by the partial degradation of sugar by the bacteria directly act on the epithelial cells [
The study found that PAMK relieves LPS-induced gosling enteritis by maintaining the small intestine morphology, cytokine, tight junctions, and immunoglobulin relatively stable and improving the disorder of intestinal flora.
All the data supporting the findings of this study are adequately included within the article.
The authors declare that there are no conflicts of interest regarding the publication of this paper.
Wanyan Li and Xuelian Xiang contributed equally to this work.
This research was funded by Fundamental and Applied Basic Research Fund Project of Guangdong Province (no. 2019A1515110106), Major Research Project of Guangdong Province Education Department (no. 2017KZDXM046), Science and Technology Planning Project of Guangzhou (no. 201604020061), and Young Innovative Talents Project of General Colleges and Universities in Guangdong Province (no. 2016KTSCX055).