Cognitive performance is an important endophenotype for various neurodegenerative and neuropsychiatric traits. In the present study two genetic variants in the leucine-zipper protein (LUZP2) and the F-box 40 protein (FBXO40) genes, previously reported to be genome-wide significant for Alzheimer’s diseases and schizophrenia, were examined for an association with cognitive abilities in normal elderly from the Russian population. Rs1021261 in the LUZP2 and rs3772130 in the FBXO40 were genotyped by multiplex PCR and MALDI-TOF mass spectrometry in a sample of 708 normal elderly subjects tested for cognitive performance using the Montreal Cognitive Assessment (MoCA). Association of genetic variability with the MoCA scores was estimated by parametric and nonparametric analysis of variance and by the frequency comparison between upper and lower quartiles of MoCA distribution. Significantly higher frequency of “TT” genotype of rs1021261 in the LUZP2 gene as well as “A” allele and “AA” genotype of rs3772130 in the FBXO40 gene was found in a subsample of individuals with the MoCA score less than 20 comparing to the fourth quartile’s subsample (MoCA > 25). The data of the present study suggests that genetic variability in the LUZP2 and FBXO40 loci associated with neurodegenerative and neuropsychiatric diseases is also contributed to the normal variability in cognitive performance in the elderly.
Cognitive decline with the age, both in the normal aging and in the pathological manifestations in form of dementia, is an important public health and social challenge. Individual variability of cognitive functions is an important endophenotype of many neurodegenerative, psychiatric, and mental diseases, such as schizophrenia (SZ) [
LUZP2 gene on chromosome 11 encodes a leucine-zipper protein of unknown function, which is normally expressed only in the brain and the spinal cord. LUZP2 gene is deleted in some patients with Wilms tumor, aniridia, genitourinary anomalies, and mental retardation (WAGR) syndrome [
FBXO40 gene on chromosome 3 encodes a member of the F-box protein family which is characterized by an approximately 40-amino acid F-box motif. F-box 40 protein is substrate-recognition component of the SCF (SKP1-CUL1-F-box protein)-type E3 ubiquitin ligase complex that may function in myogenesis and in insulin growth factor (IGF) signaling in the brain and CNS. Potentially FXBO40 may be involved in neurodegenerative and neuropsychiatric diseases through alterations of the IGF-I neuronal modulations. Genetic variants in the FBXO40 gene were found genome-wide significant for Alzheimer’s disease in the APOE e4 carriers [
Thus genetic variability in LUZP2 and FBXO40 genes may contribute to neurodegenerative and neuropsychiatric diseases as well as to normal cognitive phenotypes. This study aimed to examine whether the rs1021261 in the LUZP2 gene and rs3772130 in the FBXO40 gene are associated with cognitive performance in the normal elderly population.
A sample of 708 elderly subjects (age range between 59–89 years, the mean age 70.8 years) of Russian descent was randomly selected from a population-based cohort study on primary prevention of the Alzheimer’s disease in Tomsk, Russia [
Intronic single nucleotide polymorphic variant (SNP) rs1021261 in the LUZP2 gene resulted from the G-T transversion in the position 24660211 (human genome build GRCh38.p7) on chromosome 11. Intronic rs3772130 in the FBXO40 gene results in a substitution of A to G in the position 121625293 (GRCh38.p7) of chromosome 3. Genotyping of the two SNPs was performed by multiplex PCR with the following iPLEX primer extension reaction and detection of allele-specific extension products by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry on Sequenom MassARRAY 4 platform. Primers (Table
PCR and iPLEX primers used for genotyping of rs1021261 and rs3772130 by multiplex PCR and MALDI-TOF mass spectrometry.
Primer | Sequence (5′-3′) |
---|---|
LUZP2 rs1021261 | |
PCR forward | ACGTTGGATGTTCCCACAAAGGATTTGCAG |
PCR reverse | ACGTTGGATGCTGAAAGAATTTGTGTGAGAC |
iPLEX extension | CTCCTCATTCAGGGAAGAAAG |
| |
FBXO40 rs3772130 | |
PCR forward | ACGTTGGATGTCTCATGGTAAACCTGTTGG |
PCR reverse | ACGTTGGATGGGAAGAAATTCAACAGTGAG |
iPLEX extension | AGATTGACCTAAATGGGCA |
Single nucleotide polymorphism genotyping by MALDI-TOF mass spectrometry on Sequenom MassARRAY 4 platform. Fragments of mass spectra of specimens with different genotype. (a) Rs1021261: GG (A), GT (B), and TT (C). (b) Rs3772130: AA (A), AG (B), and GG (C).
We used two approaches to examine whether genetic variation in LUZP2 and FBXO40 genes is associated with cognitive performance in the elderly population. First, total values of individual MoCA scores were treated as quantitative trait, and associations of MoCA values with genetic variability were tested using parametric (analysis of variance, ANOVA) and nonparametric (Kruskal-Wallis test and median test) statistics implemented in the Statistica 7.0 software (StatSoft Inc.). For ANOVA analysis MoCA scores were adjusted for age and education using linear regression model. Second, the total sample was subdivided into quartiles of MoCA distribution, and differences in allele and genotype frequencies between lower and upper quartiles were estimated in case-control analysis by Fisher’s exact test.
Alleles and genotypes frequency of polymorphic variants in the LUZP2 and FBXO40 genes in a sample of 708 elderly subjects from the Russian population as well as in the first (MoCA < 20) and the fourth (MoCA > 25) quartiles of MoCA scores distribution are presented in the Table
Allele and genotype frequency of two genetic variants in LUZP2 and FBXO40 genes in the total sample and in the lower
Allele, haplotype | Total sample, | Lower quartile (MoCA < 20), | Upper quartile (MoCA > 25), | |
---|---|---|---|---|
LUZP2 rs1021261 | ||||
G | 0.691 | 0.635 | 0.667 | 0.480 |
T | 0.309 | 0.365 | 0.333 | |
GG | 0.383 | 0.428 | 0.409 | 0.809 |
GT | 0.480 | 0.414 | 0.515 | 0.096 |
TT | 0.137 | 0.158 | 0.076 | |
| ||||
FBXO40 rs3772130 | ||||
A | 0.745 | 0.799 | 0.720 | |
G | 0.255 | 0.201 | 0.280 | |
AA | 0.572 | 0.671 | 0.523 | |
AG | 0.347 | 0.257 | 0.394 | |
GG | 0.081 | 0.072 | 0.083 | 0.825 |
Significantly higher frequency of the rs1021261 “TT” genotype in the LUZP2 gene as well as the rs3772130 “A” allele and “AA” genotype in the FBXO40 gene was found in the subsample of individuals with the MoCA score less than 20 comparing to the fourth quartile’s subsample (see Table
Mean values of MoCA scores in the subjects with different genotypes in the total sample of 708 elderly and the analysis of variance results are presented in Table
One-way ANOVA analysis of MoCA scores among genotypes of genetic variants in LUZP2 and FBXO40 genes.
Genotype | | MoCA mean | MoCA std. deviation |
---|---|---|---|
LUZP2 rs1021261, | |||
GG | 268 | 21.978 | 4.002 |
GT | 336 | 22.414 | 3.759 |
TT | 96 | 21.406 | 4.113 |
All | 674 | 22.106 | 3.913 |
| |||
FBXO40 rs3772130, | |||
AA | 401 | 21.843 | 3.993 |
AG | 243 | 22.572 | 3.766 |
GG | 57 | 21.965 | 3.831 |
All | 701 | 22.106 | 3.913 |
Genetic bases of cognitive performance in normal aging and dementias are the subject of intensive research. Many common genetic variants, including dozens of SNPs and CNVs in genes of unknown relations to CNS and the brain functions, have been reported in GWAS to be contributed to cognitive performance in patients with the Alzheimer’s diseases and other neurodegenerative disorders, as well as in the healthy subjects [
Despite being controversial, literature data indicate that common genetic variation in the LUZP2 and FBXO40 genes may contribute to neurodegenerative and neurocognitive phenotypes. In the present study we examined the association of two intronic variants in LUZP2 and FBXO40, previously reported genome-wide significant for the late-onset Alzheimer’s disease, with the cognitive performance in a normal elderly population. Both variants demonstrate marginal
In the previous study the minor allele G of the rs3772130 in FBXO40 gene has been found to be associated with the higher performance in the Cambridge Neuropsychological Test Automated Battery (CANTAB) [
No direct functional evidence of the involvement of LUZP2 or FBXO40 proteins in neurodegenerative process in AD and dementia has been found. However the potential role of FBXO40 in the neurodegeneration may be associated with the modulation of insulin growth factor (IGF) signaling in the brain via participation of the Fbxo-40 protein in ligase complexes involved in the degradation of insulin receptor substrates. IGF-I is highly expressed within the brain and is essential for normal brain development [
Plausible role of the LUZP2 in neurocognitive functions may be related to its impact on neuroendocrine differentiation. Luzp2, a leucine-zipper motif containing transcription factor, is highly expressed in the brain and spinal cord [
In summary, in the present study we observed the association with cognitive performance estimated by MoCA for genetic variants in the LUZP2 and FBXO40 genes previously linked to the AD and schizophrenia in GWA studies. The data of the present study indicate that genetic variability contributed to neurodegenerative and neuropsychiatric diseases may be expressed in norm or in preclinical stages as markers of cognitive functions.
The authors declare that there are no conflicts of interest regarding the publication of this article.
This work was funded by the Russian Science Foundation (Project no. 16-15-00020).