Maize (Zea mays L.) is the most important cereal crop in the world. However, soil salinity has become a major problem affecting plant productivity due to arable field degradation. Thus, transgenic maize transformed with a salinity tolerance gene has been developed to further evaluate its salt tolerance and effects on agronomic traits. It is necessary to analyze the potential environmental risk of transgenic maize before further commercialization. Enzyme activities, physicochemical properties, and microbial populations were evaluated in saline and nonsaline rhizosphere soils from a transgenic maize line (WL-73) overexpressing BcWRKY1 and from wild-type (WT) maize LH1037. Measurements were taken at four growth stages (V3, V9, R1, and R6) and repeated in three consecutive years (2012–2014). There was no change in the rhizosphere soils of either WL-73 or WT plants in the four soil enzyme activities, seven soil physicochemical properties, and the populations of three soil organisms. The results of this study suggested that salinity tolerant transgenic maize had no adverse impact on soil properties in soil rhizosphere during three consecutive years at two different locations and provided a theoretical basis for environmental impact monitoring of salinity tolerant transgenic maize.
Major Genetically Modified Organism Breeding Project of China2016ZX08011003Scientific Research Foundation for Returned Scholars of Heilongjiang Province, ChinaLC201411Science Research Foundation of Northeast Agricultural University2012RCB211. Introduction
In China, maize (Zea mays L.) is the most important cereal crop, and the production of this crop is affected by soil salinity. This problem has become ubiquitous in many countries. Thus, many salinity-tolerant crops, such as maize and rice, have been developed using transgenic technology [1]. Researchers have found that the microbial communities in the rhizosphere are influenced by the plant. Questions have been raised about whether antibiotic resistance genes, as selective markers, can transfer from genetically modified GM plants to indigenous microbes in the soil rhizospheres. Another question is whether certain GM plants differentially affect soil microbial communities compared to non-GM plants [2, 3].
Previous studies have shown that GM plants, including GM maize, potato, soybean, rice, and triticale, are equivalent to non-GM crops in terms of nutrition and are safe as food or feed [4]. The effects of Bacillus thuringiensis (Bt) transgenic cotton (“Mech 162”) and non-Bt plants of the same cultivar on the ecology of many organisms in the soil were evaluated over three years in a subtropical environment. The authors concluded that the Bt cotton “Mech 162” did not have any negative effects on the organisms or biochemical characteristics of the soil [5]. The bacterial communities in the rhizosphere were studied using GM and non-GM maize in another study. Plant growth can promote rhizobacterial multiplication associated with both GM and non-GM plants, which indicates the mutually beneficial relationship between rhizobacteria and maize. No significant differences in the isolated rhizospheres were found during plant growth in GM or non-GM plants [6]. Using transgenic, salinity-tolerant SUV3 and PDH45 rice, the communication between rhizobacteria and rice was studied, and no significant effect was found [3, 7]. However, there have been few reports of the influence of GM and non-GM maize on rhizosphere soils [8]. The BcWRKY1 gene was cloned from Boea crassifolia Hemsl, and it encodes a 444-amino acid WRKY-like protein containing two conserved domains: WRKYGQK and C2H2 motifs. The full-length BcWRKY1 cDNA was 1,803 bp, and its expression could be induced by abiotic stresses, including soil salinity, low temperature, and drought. In addition, BcWRKY1 transcription was accompanied by changes in plant hormones, including abscisic acid (ABA), salicylic acid (SA), and jasmonic acid (JA) [9]. Then, the Boea crassifolia DNA helicase of BcWRKY1 was overexpressed under salt stress in maize. The NaCl stress-tolerant phenotype appeared even when plants were irrigated continuously with 150–200 mM NaCl, with no effect on their yield. Furthermore, other salt-induced genes, including GmWRKY54, TaWRKY2, and HvWRKY38, in Arabidopsis thaliana also promoted strong NaCl stress-tolerant phenotypes [10–12].
In this study, GM maize (WL-73) plants overexpressing the BcWRKY1 gene and control non-GM maize LH1037 were used to evaluate the effects of WL-73 growth on the microbial populations in saline or nonsaline soils in Harbin, China. BcWRKY1-transgenic maize, which carries a kanamycin resistance gene, was compared to non-GM LH1037 maize to determine its effects on rhizosphere soil in terms of enzyme activities (including dehydrogenase, alkaline phosphatase, urease, and sucrase activities), physicochemical properties, and microbial populations.
2. Materials and Methods2.1. Plant Sample Treatment
The line WL-73 was derived from the maize inbred line LH1037 transformed with the vector pCAMBIA 3300-Ubi-WRKY1 (Figure 1). Seeds were obtained from T0 antisaline transgenic maize selected by saline stress and self-crossed to T6; WL-73 plants overexpressing BcWRKY1 were able to survive under 300 mM NaCl stress [13].
Schematic of the expression vector p3300-Ubi-BcWRKY1. RB, right border; LB, left border; UBI, ubiquitin promoter; Tnos, nopaline synthase terminator; BcWRKY1, Boea crassifolia WRKY1 gene; Bar, Bialaphos resistance selectable marker gene; CaMV35S, cauliflower mosaic virus 35S promoter. HindIII, BamHI, SacI, and EcoRI are restriction endonuclease recognition sites.
The seeds of WL-73 and its receptor line LH1037 (WT) were grown in a three-row field with simulated saline-alkaline soil derived from a natural saline-alkaline field in Heilongjiang Province, China. The saline soil contained 29.42 g·kg−1 organic matter, 0.31 g·kg−1 total N, 127.27 mg·kg−1 available N (AN), 23.54 mg·kg−1 available P (AP), and 178.91 mg·kg−1 available K (K2O) (AK) and had a pH of 8.65. The nonsaline control soil contained 58.02 g·kg−1 organic matter, 0.31 g·kg−1 total N, 119.26 mg·kg−1 AN, 26.01 mg·kg−1 AP, and 267.14 mg·kg−1 AK and had a pH of 7.67.
The seeds were salt and mock treated following Di’s method with modifications [14]. WT and WL-73 seeds were germinated in sterilized vermiculite in a greenhouse with a humidity of 40–50% at 22°C and a light cycle of 16 h light/8 h darkness. The plants were well watered until the three-leaf stage. In addition, 0.5x Hoagland’s nutrient solution with 300 mmol NaCl was applied to the salt treatment plants daily for 7 days, while the same solution without NaCl was applied to the control plants at the same frequency. Both the salt-treated and control plants in the experiment were then watered with 0.5x Hoagland’s nutrient solution every 3 days to prevent excessive NaCl accumulation in the vermiculite.
2.2. Molecular Characterization and Salt Tolerance of Transgenic Maize
Leaves of the salt-treated seedlings were collected, and DNA and RNA were isolated. The CTAB method was used to isolate genomic DNA from the two youngest leaves of each plant [15]. Total RNA was isolated using TRIzol following the manufacturer’s protocol (Tiangen Biotech, Beijing, China) under the requirement of 100 mg of young seeding leaves per mL of TRIzol. Exogenous BcWRKY1 gene transcription was analyzed by RT-PCR.
The plant height and fresh weights were measured according to the methods of Di [14]. In addition, the membrane integrity parameters of the plants were determined by detecting superoxide dismutase (SOD) and peroxidase (POD) activity, proline (Pro) and malondialdehyde (MDA) content, relative electrical conductivity (REC), and chlorophyll content in leaves following the methods of Arnon [16] and Bates et al. [17].
2.3. Rhizosphere Soil Sampling
WL-73 and WT maize plants were grown in saline or conventional soil in triplicate from 2012 to 2014 at the Transgenic Experiment Station of Northeast Agricultural University, Harbin, Heilongjiang, China (longitude 126°73′, latitude 45°75′). Soil samples were isolated from the rhizosphere of WL-73 and WT at the V3 (the three lowest leaves have a visible collar), V9 (nine leaves have collars present), R1 (silking), and R6 (physiological maturity) stages. After removing the surface leaves, three soil samples from each plot were collected according to a checkerboard method. The soil volumes between 0 and 20 cm in depth were extracted using a soil auger with a 4 cm diameter, and the bulk soil on the root was shaken off. The soil from the root was stripped using a sterilizing brush and constituted the rhizosphere soil samples. We mixed three rhizosphere soil samples from each plot into one sample and then divided this sample into two. One of the samples was stored at 4°C until microbial analysis. Another sample was air-dried at room temperature, homogenized by sieving through a 2 mm mesh, and stored at 4°C until analysis.
2.4. Measurement of Soil Enzyme Activities
Dehydrogenase activity was analyzed as described by Min et al. [18]. Alkaline phosphatase activity was measured spectrophotometrically as described by Tabatabai and Bremner [19]. Urease enzyme activity was estimated as previously described [20]. Soil sucrase activity was measured using the 3,5-dinitrosalicylic acid method [21, 22].
2.5. Quantification of Physicochemical Properties
The physicochemical characteristics of soil and nutrient constituents, including soil type, pH, electrical conductivity (Ec) (mS·cm−1), organic carbon (OC) (%), AN (kg·ha−1), AP (kg·ha−1), and AK (kg·ha−1), were determined.
The soil pH and Ec were analyzed through the following steps. A 50 g soil sample was suspended in 100 mL of distilled, deionized water and stirred for 1 h at 100 rpm on a rotary shaker. The supernatant was collected by centrifugation at 10,000 ×g for 5 min. The Ec was recorded using a conductivity meter against 0.01 N KCl, and the pH was measured [23].
The available carbon, nitrogen, phosphorus, and potassium contents in the soils were determined following standard methods [24–27].
The calcium (Ca2+), sodium (Na+), and magnesium (Mg2+) ion concentrations were determined using an atomic absorption method to determine the sodium adsorption ratio (SAR) [26]. The SAR was then calculated using the following formula: (1)SAR=Na+1/2Ca2++Mg2+.
2.6. Isolation of Rhizospheric Bacteria, Actinomycetes, and Fungi
To obtain isolated colonies, serial dilutions (10−4 dilution) prepared from 1 g soil samples were streaked onto nutrient agar medium in plates. Colonies were then selected, diluted, and spread onto plates containing beef extract peptone agar to detect bacteria, Gause’s agar to detect actinomycetes, and Rose Bengal agar to detect fungi. Three replicates of the inoculated agar plates were incubated at 30°C, 28°C, or 28°C for 3 d for bacteria, 3 d for actinomycetes, and 5 d for fungi, after which the number of various types of colonies was recorded. The total populations of bacteria, actinomycetes, and fungi in each Petri dish were counted as colony forming units (cfu)·g−1 dry soil.
2.7. Data Processing Methods
This study was designed as a randomized complete block. The block treatments were the four growth stages (V3, V9, R1, and R6), the two maize materials (WL-73 and WT), and the two soil types (saline and nonsaline). All of the experiments were performed with three biological replicates over three years from 2012 to 2014. The data were analyzed statistically, and the standard error was calculated. An analysis of variance (ANOVA) was performed on treatment means using a generalized linear mixed model (GLMM), including treatment and sample time, in SAS 9.1 (Copyright 2008, SAS Institute, Cary, NC). Mean separations were performed using a least significant difference (LSD) test.
3. Results and Discussion3.1. Molecular Characterization of Transgenic Maize Plants (WL-73)
The BcWRKY1 gene was cloned from Boea crassifolia, which has the ability to tolerate salt stress [9]. WL-73 transgenic plants overexpressing the BcWRKY1 gene were successfully generated by Agrobacterium-mediated transformation with the binary vector pCAMBIA3300-Ubi-BcWRKY1 (Figure 1) introduced into the inbred line LH1037 [28].
The 1308-bp BcWRKY1 PCR product was amplified from WL-73 transgenic plants with BcWRKY1 gene-specific primers (Figure 2(a)). The transcription of the BcWRKY1 gene in plant leaves was detected by RT-PCR (Table 1, Figure 2(b)). As expected, PCR and RT-PCR bands characteristic of BcWRKY1 were detected in WL-73 but not in WT plants.
PCR and RT-PCR primers for amplifying BcWRKY1.
Primer name
Sequence (5′-3′)
Primer I
ATGTCGTCTCTCGGCTCATC
Primer II
GAGCCCAACTGATTTTCTTG
PCR and RT-PCR analyses of transformed and WT plants using BcWRKY1 primers. (a) PCR analysis of WL-73 and WT; M, DNA marker DL2000 (TaKaRa); WT, wild-type plants of LH1037; P, pCAMBIA3300-Ubi-WRKY1 plasmid; BW1-8 derived from plants of WL-73. (b) RT-PCR analysis of WL-73 and WT1; M, DNA marker DL2000 (TaKaRa); WT, wild-type plants of LH1037; P, pCAMBIA3300-Ubi-WRKY1 plasmid; BW1-8 derived from WL-73 plants.
3.2. Salt Tolerance Evaluation of Transgenic Maize Plants (WL-73)
When we treated maize plants with 300 mM NaCl solution for 7 days, the WL-73 plants were 5.3 cm taller and 60% heavier (fresh weight) than WT plants (Table 2). WT seedlings became almost entirely yellow on the 7th day after salt stress (Figure 3). The membrane integrity of the plants was measured in terms of parameters such as SOD, POD, Pro, MDA content, REC, and chlorophyll content following salt stress (Figure 4). The SOD, POD, Pro, MDA, and REC of WL-73 plants were significantly lower than those of WT plants (P<0.01), while the chlorophyll content of WL-73 plants was higher than that of WT plants under the 300 mM NaCl treatment (Table 2). However, no significant difference was found in these values between WL-73 and WT plants under control conditions. These results suggest that the membranes of WL-73 plants were less damaged than those of the WT plant.
Height and fresh weight of maize WL-73 and WT under 300 mM NaCl stress.
Parameter
7 days of non-NaCl stress
7 days of NaCl stress
WL-73
WT
WL-73
WT
Height (cm)
25.7 ± 0.42a
25.6 ± 0.34a
24.4 ± 0.70a
19.1 ± 0.81b
Fresh weight per plant (g)
5.95 ± 0.21a
5.89 ± 0.14a
5.41 ± 0.63a
3.38 ± 0.22b
SOD (U·g−1 FW)
260.60 ± 1.35a
259.80 ± 1.48a
283.59 ± 3.38a
332.02 ± 1.73b
POD (U·g−1 FW)
813.03 ± 0.19a
812.48 ± 0.47a
927.62 ± 1.40a
1,316.92 ± 1.83b
Pro (mg·g−1)
138.00 ± 0.48a
137.58 ± 0.57a
168.17 ± 2.64a
225.80 ± 3.14b
MDA (nmol·g−1)
78.41 ± 0.72a
78.33 ± 0.75a
102.44 ± 2.11a
170.89 ± 4.06b
REC (%)
0.17 ± 0.01a
0.17 ± 0.01a
0.23 ± 0.01a
0.35 ± 0.02b
Chlorophyll content (mg·g−1)
2.71 ± 0.03a
2.72 ± 0.01a
2.67 ± 0.05a
2.05 ± 0.03b
Wild-type or transgenic maize plants were treated with 0.5x Hoagland’s nutrient solution and 0 mM NaCl (control) or 300 mM NaCl for 7 days. Then, the height, fresh weight, and SOD, POD, Pro, MDA, REC, and chlorophyll contents were measured. WT, wild-type maize LH1037; WL-73, LH1037 plant transformed with BcWRKY1.
Different letters following the numbers in the same column indicate a significant (P≤0.05) difference between treatments according to the LSD test.
Enhanced salt tolerance of transgenic versus wild-type seedlings under 300 mM NaCl. Wild-type and transgenic maize plants were treated with 0.5x Hoagland’s nutrient solution and either 0 mM NaCl (control) or 300 mM NaCl for 7 days. WL-73, LH1037 plants transformed with BcWRKY1; WT, wild-type LH1037 plants. Note: salt tolerance of transgenic maize compared to WT. Photographs were taken after salt treatment. BcWRKY1-overexpressing T6 transgenic and WT maize plants under salt-stressed (300 mM NaCl) and nonstressed conditions after 7 days.
Effects of NaCl stress on the SOD, POD, Pro, MDA, REC, and chlorophyll contents of WT maize and WL-73 transgenic maize plants. WT and WL-73 were treated with 0.5x Hoagland’s nutrient solution and either 0 mM NaCl (control) or 300 mM NaCl for 7 days; then, the SOD, POD, Pro, MDA, REC, and chlorophyll contents were measured. (a) SOD content; (b) POD content; (c) Pro content; (d) MDA content; (e) REC; (f) chlorophyll content. WT, wild-type maize LH1037; WL-73, LH1037 plant transformed with BcWRKY1. ∗∗ indicates a significant difference at 0.01 according to the LSD test (n=3). The standard error is based on the average of three biological replicates. Note: the SOD, POD, Pro, MDA, and REC of WL-73 were significantly lower than those of WT (P<0.01), while the chlorophyll content of WL-73 was higher than that of WT under 300 mM NaCl treatment for 7 days.
Our results suggest that BcWRKY1 enhanced the tolerance of WL-73 plants to salinity stress via membrane stabilization and reduced REC and MDA contents compared with WT plants under salt stress (Figure 4, Table 2).
The BcWRKY1 gene has been analyzed with other stress-related genes in transgenic plants, where it enhances the tolerance to salt and drought stress [10–12]. Therefore, increasing the expression level of BcWRKY1 via transgenic technology should be critical for engineering crop plants with improved tolerance under multiple environmental stresses.
3.3. Activities of Four Enzymes in Rhizosphere Soil
The effects of WL-73 maize compared to control maize on rhizosphere soil enzyme activity, including the activities of alkaline phosphatase, urease, dehydrogenase, and sucrase, were studied in saline or control soil environments at four maize growth stages (V3, V9, R1, and R6) from 2012 to 2014. These four enzymes are the main enzymes in soil and significantly affect the growth and yield of maize. Alkaline phosphatase is mainly involved in the soil phosphorus cycle. Urease is associated with the nitrogen cycle. Dehydrogenase is the main oxidoreductase, and sucrose is the major hydrolase enzyme. During the three years of this study, the alkaline phosphatase, urease, dehydrogenase, and sucrase activities in the rhizosphere soil of WL-73 and WT plants were not different (P>0.05) in the two soil environments (saline or nonsaline) or at any of the four growth stages (V3, V9, R1, and R6). The ANOVA results showed that the dehydrogenase and alkaline phosphatase activities in the rhizosphere soil of WL-73 and WT maize were similar, with values ranging from 34.84 to 39.04 μg PNP g−1·h−1 in saline soil and from 40.74 to 57.44 μg PNP g−1·h−1 in control soil for WL-73 and from 34.74 to 41.85 μg PNP g−1·h−1 in saline soil and from 40.62 to 59.26 μg PNP g−1·h−1 in control soil for WT maize (Tables 3 and 4; Figures 5(a)–5(d)). However, the activities of these four soil enzymes were significantly different between WL-73 and WT plants in some soil environments, years, and growth stages. For example, there were significant differences in alkaline phosphatase activity in saline soil at R6 in 2013 (P=0.03); in urease activity in control soil at R1 in 2012 and in saline soil at V9 in 2013 (P<0.05); in dehydrogenase activity in control soil at V9 in 2013; and in sucrase activity in saline soil at V9 in 2014 (Table 3, Figures 5(a)–5(d)). However, no consistent trends in enzyme activity were detected in the two soil environments, over the three-year study, or in the four growth stages analyzed here. These results agree with those of previous studies in other regions and for a variety of crops [29–32].
ANOVA of the effects of year, growth stage, soil type, and maize genotype.
Number
Source
Year
Growth stage
Soil type
WL-73
WT
P value
1
pH
2013
V9
Saline
8.83
8.66
0.03∗
2
pH
2014
R1
Control
7.36
7.13
0.02∗
3
SAR
2012
V9
Saline
21.43
21.07
0.01∗
4
SAR
2014
V9
Saline
17.02
17.33
0.03∗
5
SAR
2014
V9
Control
2.14
2.78
0.01∗∗
6
AN
2013
V9
Saline
87.33
81.69
0.05∗
7
AN
2014
R6
Saline
87.33
85.60
0.03∗
8
AK
2013
V9
Saline
215.83
219.58
0.01∗∗
9
AK
2013
V9
Control
210.45
213.99
0.02∗
10
AK
2013
R6
Saline
194.23
191.55
0.01∗∗
11
AP
2013
R1
Saline
33.63
31.66
0.04∗
12
OC
2013
V9
Saline
31.59
33.96
0.03∗
13
Alkaline phosphatase
2013
R6
Saline
34.79
33.80
0.03∗
14
Urease activity
2012
R1
Control
5.76
6.49
0.04∗
15
Urease activity
2013
V9
Saline
12.87
12.65
0.05∗
16
Dehydrogenase activity
2013
V9
Control
8.86
7.14
0.03∗
17
Sucrase activity
2014
V9
Saline
25.04
24.96
0.02∗
18
Actinomycetes
2014
V9
Saline
4.16
4.02
0.05∗
19
Actinomycetes
2014
R6
Control
4.85
4.61
0.05∗
SAR, sodium adsorption ratio; AN, available nitrogen; AK, available potassium; OC, organic carbon; WT, wild-type maize LH1037; WL-73, LH1037 plant transformed with BcWRKY1; V3, the three lowest leaves have a visible collar; V9, nine leaves have collars present; R1, silking; R6, physiological maturity.
∗ indicates a significant difference at P<0.05 according to the LSD test (n=3).
∗∗ indicates a significant difference at P<0.01 according to the LSD test (n=3).
Note: only those traits with significant differences in a specific period are listed here.
ANOVA of four enzyme activities in rhizosphere soils.
Enzyme activities
Source of variation
P value
Alkaline phosphatase
Year
0.87
Soil variety
0.01∗∗
Maize variety
0.90
Stage × maize variety
0.00∗∗
Urease
Year
0.81
Soil variety
0.00∗∗
Maize variety
0.52
Stage × maize variety
0.00∗∗
Dehydrogenase
Year
0.96
Soil variety
0.87
Maize variety
0.77
Stage × maize variety
0.00∗∗
Sucrase
Year
0.56
Soil variety
0.01∗∗
Maize variety
0.88
Stage × maize variety
0.00∗∗
Years: 2012, 2013, and 2014.
Soil varieties: saline soil and nonsaline soil.
Maize varieties: WT (wild-type maize LH1037) and WL-73 (LH1037 plant transformed with BcWRKY1).
Stages: V3 (the three lowest leaves have a visible collar), V9 (nine leaves have collars present), R1 (silking), and R6 (physiological maturity).
∗∗Significant source of variation (P<0.01).
Activities of four enzymes in rhizosphere soil at different sampling times. (a) Alkaline phosphatase activity; (b) urease activity; (c) dehydrogenase activity; (d) sucrase activity. WT, wild-type maize LH1037; WL-73, LH1037 plant transformed with BcWRKY1; V3, the three lowest leaves have a visible collar; V9, nine leaves have collars present; R1, silking; R6, physiological maturity. ∗ indicates a significant difference at P<0.05 according to the LSD test (n=3). The standard error is based on the average of three biological replicates. Note: during the three years of this study, there were no overall significant differences (P>0.05) in the alkaline phosphatase, urease, dehydrogenase, or sucrase activity in rhizosphere soil of WL-73 and WT plants in two soil environments (saline or nonsaline) or at four growth stages (V3, V9, R1, and R6). In addition, the activities of these four soil enzymes were not significantly different between WL-73 and WT plants in some soil environments, years, and growth stages.
Soil enzymes play an important role in maintaining soil ecology, physicochemical properties, fertility, and health [33, 34]. The overexpression of PDH45 and SUV3 in transgenic rice has no adverse effect on rhizosphere soil or its microflora [3, 7]. In other studies of transgenic crops, the only consistent significant differences in soil enzymes and physicochemical properties between transgenic and nontransgenic plants were due to seasons and crop varieties. There were no significant differences in the enzyme activities of rhizospheric microbes from soils in which Bt or non-Bt cotton was grown [5]. The results of the present study indicated few significant differences in the alkaline phosphatase, urease, dehydrogenase, and sucrase activities in the rhizosphere soil between WL-73 and WT plants, as in the five studies cited above.
3.4. Physicochemical Properties of Rhizosphere Soil
The physicochemical properties, including the pH, SAR, Ec, AN, AK, AP, and OC, of rhizosphere soil from WL-73 and WT maize plants are shown in Figures 6(a)–6(g). There were no overall significant differences between WL-73 and WT plants for most of the physicochemical properties (P>0.05) at four maize growth periods (R1, R9, V1, and V6) in saline and control soil environments from 2012 to 2014 (Table 5). However, there were significant differences between WL-73 and WT plants (P<0.05) for nine combinations of factors and very significant differences between the genotypes for three combinations of factors. There were significant differences in specific parameters under some conditions, including pH in saline soil at V9 in 2013; pH in control soil at R1 in 2014; SAR in saline soil at V9 in 2012 and 2014; AN in saline soil at V9 in 2013 and in saline soil at R6 in 2014; AK in control soil at V9 in 2013; AP in saline soil at R1 in 2013; and organic matter in saline soil at V9 in 2013. There were very significant differences in SAR in control soil at V9 in 2014; AK in saline soil at V9 in 2013; and AK in saline soil at R6 in 2013 (Table 3; Figures 6(a)–6(g)). However, no overall consistent trends in physicochemical properties were detected in the two soil environments, over the three-year study, or in the four growth stages. This result is consistent with previous results in other plants and fields [32].
ANOVA of seven physicochemical properties.
Physicochemical properties
Source of variation
P value
EC
Year
0.9972
Soil variety
0.012∗
Maize variety
0.156
pH value
Year
0.84
Soil variety
0.001∗∗
Maize variety
0.742
SAR value
Year
0.56
Soil variety
0.001∗∗
Maize variety
0.742
AN
Year
0.87
Soil variety
0.052
Maize variety
0.038∗
AP
Year
0.62
Soil variety
0.002∗∗
Maize variety
0.791
AK
Year
0.84
Soil variety
0.033∗
Maize variety
0.935
OC
Year
0.95
Soil variety
0.012∗
Maize variety
0.513
Years: 2012, 2013, and 2014.
Soil varieties: saline soil and nonsaline soil.
Maize varieties: WT (wild-type maize LH1037) and WL-73 (LH1037 plant transformed with BcWRKY1).
∗Significant source of variation (P<0.05).
∗∗Significant source of variation (P<0.01).
Assays of seven physicochemical properties of rhizosphere soil. BcWRKY1 transgenic maize (WL-73) and nontransgenic maize (WT; LH1037) plants were grown in saline or control nonsaline soil from 2012 to 2014. Seven physicochemical parameters were measured, and a statistical analysis was performed using the LSD test with P<0.05 and n=3. (a) pH; (b) SAR value; (c) electrical conductivity; (d) available N; (e) available K; (f) available P; (g) organic matter. WT, wild-type maize LH1037; WL-73, LH1037 plant transformed with BcWRKY1; V3, the three lowest leaves have a visible collar; V9, nine leaves have collars present; R1, silking; R6, physiological maturity. ∗ indicates a significant difference at P<0.05 according to the LSD test (n=3). ∗∗ indicates a significant difference at P<0.01 according to the LSD test (n=3). The standard error is based on the average of three biological replicates. Note: no overall significant differences were observed between WL-73 and WT plants for most of the physicochemical properties (P>0.05) at four maize growth periods (R1, R9, V1, and V6) in saline and control soil environments from 2012 to 2014.
3.5. Culturable Microbial Populations in Rhizosphere Soil
The number of total actinomycetes, bacteria, and fungi per gram of dry rhizosphere soil from WL-73 and WT plants over the crop developmental cycle is shown in Figure 7. No significant differences were found in the total number of bacteria, fungi, and actinomycetes between the two maize rhizosphere soils at any of the plant growth stages, except for actinomycetes in saline soil at V9 and in control soil at R6 in 2014 (Table 3). The variation in actinomycete, bacterial, and fungal populations was consistent. The three microbial populations increased from growth stages V3 through V9. The total number of each of the three kinds of microbes in the rhizosphere soil peaked at the V1 stage. Subsequently, the populations of all three types of microorganisms decreased at the V6 stage (Figures 7(a)–7(c)).
Assays of three microbial communities in rhizosphere soil. BcWRKY1 transgenic maize (WL-73) and nontransgenic maize (WT; LH1037) plants were grown in saline or control nonsaline soil from 2012 to 2014 (P∗<0.05, n=3). We investigated the microbial populations in their rhizosphere soil. (a) Actinomycete population, (b) bacterial population, and (c) fungal population in terms of cfu (colony forming units) per g of dry soil. WT, wild-type maize LH1037; WL-73, LH1037 plant transformed with BcWRKY1; V3, the three lowest leaves have a visible collar; V9, nine leaves have collars present; R1, silking; R6, physiological maturity. ∗ indicates a significant difference at P<0.05 according to the LSD test (n=3). The standard error is based on the average of three biological replicates from 2012 to 2014. Note 1: the variation in the actinomycete, bacterial, and fungal populations was consistent. The populations of the three microbial communities increased from growth stages V3 through V9. The total number of each of the three types of microbes in the rhizosphere soil peaked at the V1 stage. Subsequently, the population levels of all three types of microorganisms decreased at the V6 stage. Note 2: to ensure consistency in the experimental data, transgenic and nontransgenic material were planted in the same pot for the three years, and each pot was handled at the same time to minimize the impact of human factors on the experiment.
Soil microbial analysis is a common method used to detect the effect of exogenous chemicals or environmental pollutants on soil fertility and crop yields. Similarly, monitoring soil microbial populations in response to transgenic plants will reveal the risks of exogenous genes in soil. Investigations of the microbial populations of rhizosphere soil found that Bt maize had no direct effect on soil ecology [34]. Both the number and the diversity of microorganisms exhibit only significant seasonal variation, with no long-term effect on the cultivation of Cry1Ac-transgenic cotton [32]. No significant effects were found on the populations of various soil microorganisms with the growth of transgenic insect-resistant maize, Bt maize, and cotton compared to nontransgenic plants under field conditions [30, 31, 35–37]. There was no adverse effect on soil enzymatic activities or rhizosphere microbial communities by the cultivation of transgenic plants, such as MCM6 transgenic tobacco, PDH45 transgenic rice, and SUV3-overexpressing transgenic rice [3, 7, 37].
In our study, significant variation was detected in actinomycete populations in saline soil at V9 and in control soil at R6 in 2014 (P>0.05). However, we did not find a significant effect on enzyme activities, physicochemical properties, or populations of soil microbes due to the long-term cultivation of WL-73 compared to WT. Our results are consistent with previous studies showing that the long-term cultivation of salt-tolerant GM plants has no effect on soil microbial populations. The effects that we observed were due to particular individual plants, techniques, exogenously expressed proteins, or environmental conditions.
4. Conclusions
In the present study, the minor significant differences in the rhizosphere soil between transgenic and nontransgenic maize plants were not as large as the effects associated with plant growth stages. These results indicated that the effects of BcWRKY1 maize WL-73 on rhizosphere soil ecology are within the variation expected in conventional agriculture. The long-term planting (3 years) of WL-73 plants had no detectable effects on the enzymatic activities, physicochemical properties, or microbial populations of the rhizosphere soil compared with the WT at any of four maize growth stages (V3, V9, R1, and R6).
Competing Interests
The authors declare no conflict of interests.
Authors’ Contributions
Xing Zeng and Yu Zhou contributed equally to this research.
Acknowledgments
The authors would like to thank Professor Zhongping Lin at the College of Life Science, Peking University, for his kind gift of the recombinant plasmid pCAMBIA3300-Ubi-WRKY1. This work was supported by the Major Genetically Modified Organism Breeding Project of China (2016ZX08011003); the Scientific Research Foundation for Returned Scholars of Heilongjiang Province, China (LC201411); and the Science Research Foundation of Northeast Agricultural University (2012RCB21).
PatnaikB. B.ParkS. Y.KangS. W.Transcriptome profile of the Asian giant hornet (Vespa mandarinia) using Illumina hiseq 4000 sequencing: De novo assembly, functional annotation, and discovery of SSR markers2016201615416958710.1155/2016/4169587LynchJ. M.BenedettiA.InsamH.NutiM. P.SmallaK.TorsvikV.NannipieriP.Microbial diversity in soil: ecological theories, the contribution of molecular techniques and the impact of transgenic plants and transgenic microorganisms200440636338510.1007/s00374-004-0784-92-s2.0-11244324812SahooR. K.TutejaN.Effect of salinity tolerant PDH45 transgenic rice on physicochemical properties, enzymatic activities and microbial communities of rhizosphere soils20138811311610.4161/psb.249502-s2.0-84881036981SnellC.BernheimA.BergéJ.-B.KuntzM.PascalG.ParisA.RicrochA. E.Assessment of the health impact of GM plant diets in long-term and multigenerational animal feeding trials: a literature review2012503-41134114810.1016/j.fct.2011.11.0482-s2.0-84856494518MinaU.ChaudharyA.KamraA.Effect of Bt cotton on enzymes activity and microorganisms in rhizosphere2011319610410.5539/jas.v3n1p96AhmadN.ShinwariZ. K.BashirS.Function and pulogenetic characterization of rhizospheric bacteria associated with GM and non GM maize201345517811788SahooR. K.AnsariM. W.TutejaR.TutejaN.Salt tolerant SUV3 overexpressing transgenic rice plants conserve physicochemical properties and microbial communities of rhizosphere20151191040104710.1016/j.chemosphere.2014.08.0112-s2.0-84919754787BaumgarteS.TebbeC. C.Field studies on the environmental fate of the Cry1Ab Bt-toxin produced by transgenic maize (MON810) and its effect on bacterial communities in the maize rhizosphere20051482539255110.1111/j.1365-294X.2005.02592.x2-s2.0-21244448034LiuG.HuY.ZhaoF.ZhuJ.LinZ.Molecular cloning of BcWRKY1 transcriptional factor gene from Boea crassifolia hemsl and its preliminary functional analysis20074344464522-s2.0-34547622106ZhouQ.-Y.TianA.-G.ZouH.-F.XieZ.-M.LeiG.HuangJ.WangC.-M.WangH.-W.ZhangJ.-S.ChenS.-Y.Soybean WRKY-type transcription factor genes, GmWRKY13, GmWRKY21, and GmWRKY54, confer differential tolerance to abiotic stresses in transgenic Arabidopsis plants20086548650310.1111/j.1467-7652.2008.00336.x2-s2.0-43449095701NiuC.-F.WeiW.ZhouQ.-Y.TianA.-G.HaoY.-J.ZhangW.-K.MaB.LinQ.ZhangZ.-B.ZhangJ.-S.ChenS.-Y.Wheat WRKY genes TaWRKY2 and TaWRKY19 regulate abiotic stress tolerance in transgenic Arabidopsis plants20123561156117010.1111/j.1365-3040.2012.02480.x2-s2.0-84862789238MarèC.MazzucotelliE.CrosattiC.Hv-WRKY38: a new transcription factor involved in cold and drought-response in barley200455339941610.1007/s11103-004-0906-7ShanC. J.LiuX.LiuS. Y.Identification of salt-tolerance of transgenic maize with BcWRKY1 Gene2012202732DiH.TianY.ZuH.MengX.ZengX.WangZ.Enhanced salinity tolerance in transgenic maize plants expressing a BADH gene from Atriplex micrantha2015206377578310.1007/s10681-015-1515-z2-s2.0-84946125302MurrayM. G.ThompsonW. F.Rapid isolation of high molecular weight plant DNA19808194321432610.1093/nar/8.19.43212-s2.0-0019321718ArnonD. I.Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris194924111510.1104/pp.24.1.1BatesL. S.WaldrenR. P.TeareI. D.Rapid determination of free proline for water-stress studies197339120520710.1007/BF000180602-s2.0-0009069024MinH.YeY.-F.ChenZ.-Y.WuW.-X.YufengD.Effects of butachlor on microbial populations and enzyme activities in paddy soil200136558159510.1081/pfc-1001061872-s2.0-0034784657TabatabaiM. A.BremnerJ. M.Use of p-nitrophenyl phosphate for assay of soil phosphatase activity19691430130710.1016/0038-0717(69)90012-12-s2.0-0345768074WeaverR. W.MickelsonS. H.1994Soil Science Society of AmericaMillerG. L.Use of dinitrosalicylic acid reagent for determination of reducing sugar195931342642810.1021/ac60147a0302-s2.0-33747333106NizovaA. A.Study of sucrase activity in turf-podzol heavy-loamy soil19693823363392-s2.0-0014488961GuptaP. K.2004AgrobiosWalkleyA.BlackI. A.An examination of the degtjareff method for determining soil organic matter, and a proposed modification of the chromic acid titration method1934371293810.1097/00010694-193401000-000032-s2.0-84929047274RathjeJackson, M. L.: Soil Chemical Analysis. Verlag: Prentice Hall, Inc., Englewood Cliffs, NJ. 1958, 498 S. DM 39.40195985325125210.1002/jpln.19590850311RahimiH.PaziraE.TajikF.Effect of soil organic matter, electrical conductivity and sodium adsorption ratio on tensile strength of aggregates2000543-414515310.1016/S0167-1987(00)00086-62-s2.0-0034018078PageA. L.Methods of Soil Analysis, Part 2: Chemical and Mineralogical Properties1982LiangG. D.LuC. H.WangZ. H.Introduction of BcWRKY1 gene mediated by agrobacterium tumefacien into shoot tip of maize20111935658FloresS.SaxenaD.StotzkyG.Transgenic Bt plants decompose less in soil than non-Bt plants20053761073108210.1016/j.soilbio.2004.11.0062-s2.0-15244354597GriffithsB. S.CaulS.ThompsonJ.BirchA. N. E.ScrimgeourC.CortetJ.FoggoA.HackettC. A.KroghP. H.Soil microbial and faunal community responses to Bt maize and insecticide in two soils200635373474110.2134/jeq2005.03442-s2.0-33646589673ShenR. F.CaiH.GongW. H.Transgenic Bt cotton has no apparent effect on enzymatic activities or functional diversity of microbial communities in rhizosphere soil20062851-2149159LiX.LiuB.CuiJ.LiuD.DingS.GilnaB.LuoJ.FangZ.CaoW.HanZ.No evidence of persistent effects of continuously planted transgenic insect-resistant cotton on soil microorganisms20113391-224725710.1007/s11104-010-0572-22-s2.0-78651447193SinsabaughR. L.AntibusR. K.LinkinsA. E.An enzymic approach to the analysis of microbial activity during plant litter decomposition1991341–4435410.1016/0167-8809(91)90092-c2-s2.0-0025955148OliveiraA. P.PampulhaM. E.BennettJ. P.A two-year field study with transgenic Bacillus thuringiensis maize: effects on soil microorganisms20084051–335135710.1016/j.scitotenv.2008.05.0462-s2.0-52949103287GriffithsB. S.CaulS.ThompsonJ.BirchA. N. E.ScrimgeourC.AndersenM. N.CortetJ.MesséanA.SausseC.LacroixB.KroghP. H.A comparison of soil microbial community structure, protozoa and nematodes in field plots of conventional and genetically modified maize expressing the Bacillus thuringiens is CryIAb toxin20052751-213514610.1007/s11104-005-1093-22-s2.0-27944503579IcozI.StotzkyG.Cry3Bb1 protein from Bacillus thuringiensis in root exudates and biomass of transgenic corn does not persist in soil200817460962010.1007/s11248-007-9133-82-s2.0-46649114386ChaudhryV.DangH. Q.TranN. Q.MishraA.ChauhanP. S.GillS. S.NautiyalC. S.TutejaN.Impact of salinity-tolerant MCM6 transgenic tobacco on soil enzymatic activities and the functional diversity of rhizosphere microbial communities2012163851151710.1016/j.resmic.2012.08.0042-s2.0-84867626404