Steered fermentation by microorganisms gives great added value in the nutritional quality of local food. Ginger rhizome naturally contains a myriad of bioactive compounds including polyphenol and flavonoids. The aim of this work was to ferment the ginger juice, to evaluate the biochemical parameters of ginger wine, and to understand the involvement of microorganisms in the bioincrease of polyphenol compounds. Titratable acidity and pH values were determined and showed that pH is around 1.6 at the end of the fermentation when the acidity is around 6.431 g/L. Using colorimetric assay, the total polyphenolic and flavonoid compounds were evaluated throughout the fermentation. The variation of the polyphenol and flavonoid concentrations of the unsweetened sample was around 10.18 to 14.64 mg Eq AG/g and 1.394 to 2.224 mg Eq Cat/g Ms, but those from the sweet sample were around 10.82 to 18.34 mg Eq AG/g Ms and 1.311 to 2.290 mg Eq Cat/g. Using one-step PCR, multiplex techniques with specific primers, with yeast-like phenotype 27.27% (6), have been assigned among 22 isolates to
Ginger, from its scientific name
The crop of rhizome has been known to harbor multiple virtues such as lowering cholesterol levels and preventing cancer [
The choice of rhizome is justified by the fact that ginger juice is the traditional cold drink that is the most consumed in the Republic of the Congo, and ginger contained several bioactive compounds [
The ginger rhizomes were first bought at Brazzaville local markets including Bacongo, Makélékéle, and Bouemba Markets. 80 g of ginger rhizomes was vigorously washed and ground and 1 L of water was added (i.e., 10%). After sifting the mixture, 120 g of sucrose (Nkayi) was added (i.e., 12%). The mixture was distributed in eight containers containing 1 L of the samples dedicated to be tested. The fermentation process of each sample was followed for seven days. The first day has been considered as Day 1 and so on till day 7. Samples were systematically analyzed for biochemical and microbiological qualities. By using HANNA pH-meter HI 99161, pH values of the ginger wine were determined each day by direct measurement. In the side experiments, samples have been performed for the titratable acidity of the ginger wine during fermentation by titrimetry using a 0.05 N sodium hydroxide solution, in the presence of 1% phenolphthalein as an indicator. The calculation of the alcohol rate has been done at the end of fermentation by using seven samples of fermented ginger wine (E1, E2, E3, E4, E5, E6, and E7) at the end of the fermentation (day 7), and this was extended until the twentieth day (day 20). 250 mL of each fermented ginger wine samples was measured, poured into a 1 L flask, and then connected to the refrigerant. The fermented drink was heated to the boiling point. Distillation is stopped after collecting more than 3/4 of the volume of the test tube. For this, heating is stopped, the flask is cooled to remove the remaining wine, and the distillate is then brought to room temperature of the wine. The percentage of alcohol is evaluated at 20°C by using an alcoholometer.
The ginger roots were washed thoroughly with water and cut into thin rings. After having ground these rings with the aid of a mortar, the grounded product obtained was dried in an oven set at 50°C for 72 hours. The extracts to be used for the determination of total polyphenols were obtained by mixing 50 g of the dried plant material in 500 mL (10%) of distilled water in Erlenmeyer flask. The mixtures are stirred for 72 hours and then filtered. The filtrate obtained is distributed in six small vials due to 30 mL. Another part of the filtrate is chaptalized by adding 20 g of the sugar (SARIS, Nkayi) (4%) until complete dissolution. The samples are analyzed at T0 (first day), T1 (4 days of fermentation), T2 (8 days of fermentation), T3 (12 days of fermentation), and T4 (16 days of fermentation). The contents of vials T0 to T4 have been kept at shelter from light waiting to be analyzed.
The reagent used is the “Folin–Ciocalteu” reagent. The total polyphenolic compounds are determined in the following manner. 0.1 mL of the plant extract is introduced into Eppendorf tube, the extract is then diluted with 0.9 mL of distilled water, then 0.9 mL of the Folin–Ciocalteu reagent (1 N) is added, and then immediately, 0.2 mL of Na2CO3 solution (20%) is added. The mixture obtained is incubated at room temperature for about 40 minutes, protected from light. The absorbance is then measured using a spectrophotometer at 725 nm with a methanol solution used as a blank. Calibration line is previously carried out before analysis with gallic acid under the same conditions as the samples to be analyzed. The results obtained are expressed in mg gallic acid equivalent per gram of dry matter (E AG/g Ms).
The reagents used consist of the colorless solution of sodium nitrite (NaNO2, 5%) and aluminum chloride (AlCl3, 10%). The total flavonoids are evaluated by colorimetry; 250
At the end of 7 days of fermentation, the ginger wine was collected to make microbiology assessment. Dilutions were done, and microorganism suspension was streaked on Sabouraud supplemented with chloramphenicol, 100
Some
To assess the amylolytic, cellulolytic, and pectinolytic activities, an overnight culture was carried out on Petri dishes containing LB medium for the purpose of well-isolated colonies. Then, a young bacterial colony was deposited on the surface on solid LB medium separately added to 1% of starch, 0.5% of cellulose, and 0.5% of pectin. The Petri dishes are incubated 48 h to 72 h. The revelation is made with Lugol. A test is positive if there is a clear halo around the colony corresponding to a lysis range. The percentage of enzymatic activity was determined according to the following formula: % = DT-DC/DT with DT: total lysis diameter (lysis area + colony diameter); DC: colony diameter; and %: percentage of lysis.
The recent molecular identification using the
Primers used in this work.
Oligo names | 5’----3’ | Size (pb) | Targeted species | References |
---|---|---|---|---|
Ba.IdMa-F | GCGCAGTCCGTGCCTTACGGCGT | 828 | [ | |
Ba.IdMa-R | TTACTGAGCTGCCGCCTGTACG | |||
Bl.Id.Ma-F | GCGCAAACCGTTCCTTACGGCAT | 825 | ||
Bl.Id.Ma-R | TTATTGAGCGGCAGCTTCGAC | |||
Bs.Id.Ma-F | GCGCAATCTGTTCCTTATGGCAT | 835 | ||
Bs.Id.Ma-R | TTATTGTGCAGCTGCTTGTACGTTGA | |||
Bp.Id.Ma-F | GCACAAACCGTCCCTTATGGAAT | 828 | ||
Bp.Id.Ma-R | TTAGTTAGAAGCCGCTTGAGCG | |||
Bm.Id.Ma-F | GCGCAATCTGTTCCTTACGGCAT | 837 | ||
Bm.Id.Ma-R | TTATTGTGCAGCTGCCTGCAC | |||
Bsa.Id.Ma-F | GCACAAACCGTCCCTTATGGAAT | 828 | ||
Bsa.Id.Ma-R | TTAGTTAGAAGCCGCTTGAACGTTG | |||
Bat.Id.Ma-F | GCTCAGTCA GTACCTTATG GCAT | 828 | ||
Bat.Id.Ma-R | TTATTGCGCTGCTGCCTGAACG | |||
Bal.Id.Ma-F | GGTCAAAGCGTCCCTTATGGTA | 828 | ||
Bal.Id.Ma-R | TTATCGTGCAGCTTTTTGTAC | |||
Sbay F1 | GCTGACTGCTGCTGCTGCCCCCG | 275 | [ | |
Sbay R1 | TGTTATGAGTACTTGGTTTGTCG | |||
Scer F2 | GCGCTTTACATTCAGATCCCGAG | 150 | ||
Scer R2 | TAAGTTGGTTGTCAGCAAGATTG | |||
Sarb_F1 | GGCACGCCCTTACAGCAGCAA | 349 | ||
Sarb_R2 | TCGTCGTACAGATGCTGGTAGGGC | |||
Skud_F2 | ATCTATAACAAACCGCCAAGGGAG | 660 | ||
Skud_R1 | CGTAACCTACCTATATGAGGGCCT | |||
Smik_F1 | ACAAGCAATTGATTTGAGGAAAAG | 508 | ||
Smik_R1 | CCAGTCTTCTTTGTCAACGTTG | |||
Spar_F7 | CTTTCTACCCCTTCTCCATGTTGG | 739 | ||
Spar_R7 | CAATTTCAGGGCGTTGTCCAACAG |
Principal component analysis (PCA) was used to investigate possible correlations between isolates and enzymatic activity. Prior to ordination, percentage of enzymatic activity data was transformed to better meet the assumptions of normality [
Ginger wine is not a local drink. We tried to make this drink by performing the chaptalization technique of adding sugar with ginger juice. Figure
The lab process of fermentation of ginger wine.
The measurements of the pH values obtained from the 1st day of fermentation until the 7th of fermentation are presented (Figure
Determination of pH, titratable acidity, and alcohol content of ginger wine. (a) Evaluation of pH during fermentation of ginger. (b) Titratable acidity: days 1, 2, 3, 4, 5, 6, and 7. (c) Alcohol content of different samples. E1, 2, 3, 4, 5, and 7-7j: samples collected after the seventh day. E1, 2, 3, 4, 5, and 7-20j: samples collected after the 20th day.
Polyphenols constitute a family of organic molecules widely present in the plant kingdom. They are characterized, as the name suggests, by the presence of at least two phenolic groups associated in more or less complex structures, generally of high molecular weight. In order to quantify these molecules, we carried out as mentioned in the methods. As results, we showed that for the unsweetened sample, the polyphenol concentration varies from 10.18 to 14.9 mg Eq AG/g Ms after 16 days of fermentation (Figure
Bioincrease of polyphenol (a) and flavonoids (b) during the fermentation of ginger juice from a sweet sample (SS) and nonsugar added sample (SNS). T0: first day, T1: fourth day after fermentation, T2: eighth day after fermentation, T3: twelfth day after fermentation, T4: sixteenth day after fermentation, and T5: twentieth day after fermentation.
The ability isolates suspected like
Illustration of some enzymatic activities carried out on isolates from ginger wine. (a) Proteolytic activity. (b) Cellulolytic activity. (c) Amylolytic activity. (d) Pectinolytic activity. RM1, 2, 3, 8, 9, and 10: isolates.
The halo diameters were evaluated in centimeters (cm) after 24 hours of incubation at 37°C. A total of forty isolates tested positive for the proteolytic test; eighteen of the forty-four isolates exhibited cellulolytic activity with varying diameters. Twenty and twenty-five out of forty-four isolates tested were positive for the amylolytic and pectinolytic activities after 24 h, respectively. In dial (a), the isolates only developed amylolytic activity (RM29, 38, and 39); in dial (b), the isolates developed all amylolytic, cellulolytic, pectinolytic, and proteolytic activities. In dial (c), we note the isolates have the cellulolytic (RM37) and proteolytic (RM8, 11, 16, 18, 22, 25, 26, 27, 32, 34, 35, 43, and 44) activities. Finally, in dial (d), bacterial isolates have developed only pectinolytic activity (RM14, 17, 20, 21, 23, 28, 30, 36, and 42) (Figure
(a) PCA of isolates with one enzymatic activity: proteolytic (ProAc), cellulolytic (CelAc), amylolytic (AmyAc), and pectinolytic (PecAc). (b) PCA of isolates with one enzymatic activity (Act1), 2 enzymatic activities (Act2), 3 enzymatic activities (Act3), and 4 enzymatic activities (Act4): PCA: principal component analysis. RM1 to 44: isolates 1 to 44.
With the exception of RM4, 9, 13, 30, and 37, all the isolates are capable of degrading the casein used as a substrate by the proteases secreted by bacteria of the bacillus genus. However, very variable percentages have been observed with regard to the ability to degrade cellulose, pectin, and amylose. RM1, 5, 7, 12, 19, 40, and 41 are part of those where the percentages are up to 30%. Other isolates have percentages between 0 and 10% (Figure
PCA of isolates with interesting percentage of enzymatic activities: proteolytic, cellulolytic, amylolytic, and pectinolytic. PCA: principal component analysis. RM1 to 44: isolates 1 to 44.
By using Sabouraud and Mossel, 22 isolates with yeast orientation and 44 isolates with
(a) 1% agarose gel electrophoresis after amplification using 2 pairs of oligonucleotides of the isolates (OM4, OM5, OM13, OM15, OM17, OM18, OM19, and OM20). MW: molecular weight. (b) The electrophoretic profile on agarose gel (1%) obtained using the fibE-specific primers to each species of
Isolates with good profiles based on enzyme activities were selected for the extraction of genomic DNA. A total of seven isolates were selected: RM1, 3, 5, 7, 12, 19, 23, 40, and 41. The revelation was made on 1% agarose gel by using BET. After the amplification using the specific primers, the results show that only three pairs of specific primers allowed the amplification of the fibE gene, in particular the couple fibE-Bp, fibE-Bl, and fibE-Bsa, primers targeting, respectively,
The aim of this work was to understand the involvement of microorganisms in the bioincrease of phenolic compounds during the fermentation of ginger juice. In this way, we have first of all made the ginger wine and, as a result of biochemical analysis, the alcoholic degree after distillation is between 35 and 45%. These high levels of alcohol could be explained by the presence of microorganisms such as yeasts [
In this work, we have shown that polyphenols and flavonoids increase during fermentation of ginger. Microorganisms are strongly implicated in this process [
The total polyphenol concentrations of the unsweetened sample vary from 10.18 to 14.64 mg Eq AG/g Ms. As fa as the sweet sample is concerned, values vary from 10.82 to 18.34 mg Eq AG/g Ms. The flavonoid concentrations in the unsweetened sample range from 1.394 to 2.224 mg Eq Cat/g. The flavonoid concentrations in the sweet sample vary from 1.311 to 2.290 mg Eq Cat/g. It is possible to accept that chaptalization is an important factor for promoting the growth of yeasts. The high density of microorganisms linked to the secretion of pectinolytic, amylolytic, and cellulolytic enzymes explains this increase. These enzymes are directly responsible for the destruction of the cell walls of plant cells, thereby causing this increase [
The genus
Several studies reported that fermentation influences the polyphenolic profile of extracts obtained from various plant sources or during the fermentation of plant sources. This concerns
The consumption of rhizomes or ginger juice is a real health ally. The nutritional quality of people with diabetes remains a real challenge in the Republic of the Congo. In this work, we have shown that the fermentation process of ginger juice is necessary to obtain the high values of antioxidants like polyphenols and flavonoids. People with diabetes and obesity can also consume ginger without the need to add sugar. Microorganisms like
The Excel sheet including the data used to support the findings of this study is available from the corresponding author upon request.
The authors declare no conflicts of interest.
The authors are grateful to Dr. Aimé Bertrand Madiélé Mabika and Dr. Tsiba Gouollally (Faculté des Sciences et Techniques, Université Marien Ngouabi) for the technical support and to Prof. Clobite Bouka Biona (Institut National de Recherche en Sciences Exactes et Naturelles (IRSEN), Brazzaville, Congo), Prof. Arsen Lenga (Faculté des Sciences et Techniques, Université Marien N’GOUABI), and Prof Michel Dzondo Gadet (Ecole Normle Supérieure Polytechnique, Université Marien N'GOUABI) for their continuous encouragement and helpful data analysis before publication.