Water-soluble fluorescent conjugated polymer is a promising material which could be used as an optical platform in highly sensitive molecular sensors. In this paper, a simple label-free DNA sensor, which consisted of a poly(3-alkoxy-4-methylthiophene) and an aptamer, was used to detect L-argininamide (L-Arm). Due to the specific binding reaction between L-Arm and its aptamer, the proposed method can easily determinate the L-Arm through the recovery of fluorescence without any modification. Other ions or similar molecules had little effect on the detection. Moreover, there was a linear relationship between fluorescence intensity and the concentration of L-Arm. The detection limit of L-Arm was as low as 4.7 nM.
Recently, the use of water soluble fluorescent conjugated polymers (CPs) as either chemical or biological sensing elements has received wide interest [
Aptamer, a kind of one single-stranded DNA or RNA sequences, can be synthesized with the systematic evolution of ligands by the exponential enrichment (SELEX) procedure [
In this paper, we propose utilizing water-soluble fluorescent polythiophene derivative and aptamer for detecting L-Arm. On one hand, thiophene polymer can be easily prepared through oxidation of the corresponding monomers; on the other hand, thiophene polymer can detect, transduce, and possibly amplify chemical, biological, and physical changes into measurable optical or electrical signals with very high sensitivity [
Poly(1H-imidazolium-1-methyl-3-{2-[(4-methyl-3-thienyl)-oxy]ethyl})chloride (PT) was synthesized according to the previously published literatures [
Aptamer sequences used in the experiment from the literature [
Name | Sequence | Conformation |
---|---|---|
A1 | ACCGATCGAAACGTAGCGCCTTCGATCGGT | Hairpin |
A2 | AGCGATCGAACGTCACCGGATTCGATCGCT | Hairpin |
A3 | AGACCAGGGCAAACGGTAGGTGAGTGGTCT | Hairpin |
A4 | GATCGAAACGTAGTCTCCCGATCGCATCGT | Linear |
L-Arm and all oligonucleotides were purchased from a biological engineering cooperation. The concentration of DNA was determined by measuring the absorbance at 260 nm in a 3 mL quartz cuvette. Tris(hydroxymethyl)aminomethane (Tris) was purchased from a chemical company. Unless other specified, the rest reagents were analytical grade and used without further purification. The water used was purified through a purification system (≥18 MΩ). Fluorescence measurements were acquired in 3-mL quartz using a luminescence spectrometer equipped with a temperature-controlled cuvette holder and a circulating bath. The pH of solution was measured with a pH meter.
As shown in Figure
The fluorescence spectra of thiophene polymer in a different aptamer solution. The concentrations of polymer and aptamer were 1.0 × 10−6 M and 3.3 × 10−8 M. Tris-HCl was 0.01 M and contained 0.1 M NaCl, pH 7.4 at room temperature.
The fluorescence spectra of thiophene polymer in different aptamer and L-Arm solutions. The concentrations of polymer, L-Arm, and aptamer were 1.0 × 10−6 M, 1.0 × 10−6 M, and 3.3 × 10−8 M, respectively. Tris-HCl was 0.01 M and contained 0.1 M NaCl, pH 7.4 at room temperature.
The fluorescence spectra of thiophene polymer in a different aptamer solution. The concentrations of polymer, L-Arm, and aptamer were 1.0 × 10−6 M, 1.0 × 10−6 M, and 3.3 × 10−8 M, respectively. Tris-HCl was 0.01 M and contained 0.1 M NaCl, pH 7.4. Detection temperature was 45°C.
Only under a certain temperature, PT, L-Arm and A1 could constitute a stable complex, and the fluorescence of the system recovered to maximum level. Therefore, proper reaction temperature was important for fluorescence recovery. As shown in Figure
The influence of temperature on the fluorescence intensity. The concentrations of polymer, L-Arm, and A1 were 1.0 × 10−6 M, 1.0 × 10−6 M, and 3.3 × 10−8 M, respectively. Tris-HCl was 0.01 M and contained 0.1 M NaCl, pH 7.4. Detection temperature was 45°C.
pH of the buffer system was another factor which could have potential impact on the intensity of fluorescence. In order to investigate the influence on recovery efficiency, a different pH value of the buffer solution was prepared for the experiment. Figure
The influence of buffer on the fluorescence intensity. The concentration of polymer, L-Arm and A1 were 1.0 × 10−6 M, 1.0 × 10−6 M and 3.3 × 10−8 M, respectively. Tris-HCl was 0.01 M contained 0.1 M NaCl. Detection temperature was 45°C.
Under room temperature, even with the addition of L-Arm to the solution consisting of A1 and polymer, the fluorescence of the system could not be recovered. Only under a certain circumstance, for example, after heating, A1, polymer, and L-Arm developed a loop formation (Figure
Schematic description of the interaction between aptamer, polymer and L-Arm.
Since the addition of L-Arm could make the fluorescence recovery, it was hoped that the aptamer and polymer composite could quantitatively reflect the amount of L-Arm added. As shown in Figures
Fluorescence spectra of the system after the addition of different concentration of L-Arm.
The linear plots of increased fluorescence intensity at the different concentration of L-Arm.
In order to verify the specific detection of the aptamer to L-Arm, three controlled experiments with addition of K+, arginine, and BSA (bovine serum albumin) were carried out under identical conditions. In the previous studies, single-stranded DNA with G-rich sequences was able to fold into secondary structures quadruplex via intramolecular hydrogen-bonding interactions in the presence of K+ [
The effect of different disturbances on the inflorescence of the system.
The concentrations of polymer, L-Arm, A1, K+, Arg, and BSA were 1.0 × 10−6 M, 1.0 × 10−6 M, 3.3 × 10−8 M, 1.0 × 10−6 M, 1.0 × 10−6 M, and 1.0 × 10−6 M, respectively. Tris-HCl was 0.01 M and contained 0.1 M NaCl, pH 7.4. Detection temperature was 45°C.
In summary, we have developed an exceptionally simple, rapid, and specific method for detection of L-Arm without any complicated protocols or laborious modification. When aptamer, a special oligonucleotide, quenched the fluorescence of the polymer, the addition of L-arm could make the fluorescence recover under a certain condition. The quenching and recovery mechanisms are ascribed to the electrostatic interactions and energy transfer between polymer and aptamer. Moreover, the recovered emission intensity is proportion to the concentration of L-Arm, whereas a new homogeneous assay measurement for L-Arm is established with a LOD as low as 4.7 nM. Since other substances did not have the obvious influence on the fluorescence of the system, the method could be applied for specific detection of L-Arm.
This work was supported by the National Science Foundation of China (20575046), the Science Fund for Creative Research Groups of NSFC (20621502), and the Scientific Research Fund of Wuhan Institute of Technology (13102051).