We investigated the protective effect of benidipine, by testing the changes of the activity of Rho kinase and transdifferentiation of renal tubular epithelium cells
Benidipine is a triple calcium channel blocker, simultaneously blocking L, T, and N type channels. It is reported that the effect on T channel is stronger than that on L channel [
It was suggested that fasudil, a Rho kinase inhibitor, may attenuate EMT through reduced activation of RhoA/ROCK signaling and be a renoprotective agent for the treatment of DN [
Based on that, in this study, we proposed that by inhibiting Rho kinase activity, benidipine reduces epithelium-mesenchymal transdifferentiation and protects kidney in rats with type 1 diabetes (T1DM). By treating type 1 diabetic rats with benidipine and using Rho kinase inhibitor fasudil as positive control, we studied the effects of benidipine on the activity of Rho kinase and EMT in diabetic nephropathy
Eight-week old male Wistar rats weighed at 180–200 g (SPF class) were supplied by The Center for Animal Experiment of Wuhan University (Produce Permission no. SCXK (Yu) 2003-0004, Environment Permission no. SYXK (Yu) 2004-0027). Rabbit antibody p-MYPT1 (p853) and E-cadherin antibody were purchased from Bioworld Technology, USA, ROCK1 antibody was purchased from Santa Cruz, USA, rabbit antibody
Fifty-four SPF male Wistar rats were fed with normal chow diet, had free access to water, with room temperature of 20~25°C and relative humidity of 40%~70%, and were in the 12 h light-dark cycle. The rats were randomly assigned into normal group (
One day prior to the sacrifice, 24-hour urine was collected in metabolic chamber. On the same day of sacrifice, tail artery blood pressure was measured with noninvasive blood pressure meter and blood samples were collected. After rinsing with normal saline, some of the kidney tissues were fixed with 10% neutral formalin, embedded with paraffin, made into 3
Twenty-four-hour urine protein quantification was measured with sulfosalicylic acid method; serum creatinine (Scr) was tested with picric acid method; blood glucose was tested with glucose oxidase method; and NAG activity was measured with colorimetry as described previously [
Deparaffin the slides routinely, heat repair with microwave, incubate in 3% peroxide at room temperature for 15 minutes, and rinse with PBS (pH 7.4) for three times, 5 minutes for each. Add rabbit antibody p-MYPT1 (1 : 50),
The total proteins of kidney tissues were extracted with total protein extraction kit. The protein concentration was analyzed with UV spectrophotometry at 260 nm wavelength. Thirty
Take the kidney cortex tissue 0.1 g from each rat, extract total RNA with TRIzol, and remove genomic DNA with DNase I. Reverse RNA and obtain cDNA. The fluorescence PCR quantification of cDNA was performed with SYBR Green, with triplets for each sample per protocol. The total volume of each reaction was 30
Primer sequences for ROCK1 and
Primers | Primer sequences | Product | Denature |
---|---|---|---|
Rock1 | Forward: AAGAGAGTGATATTGAGCAGTTGCG | 192 bp | 61°C |
Reverse: TTCCTCTATTTGGTACAGAAAGCCA | |||
| |||
|
Forward: AAGATGACCCAGATCATGTTTGAG | 146 bp | 60°C |
Reverse: TAGATGGGCACAGTGTGGGTG |
SPSS (version14) was used for data analysis. Normal distributed quantitative variables were presented as mean ± SD. Comparison among groups was performed with ANOVA, SNK, and LSD tests. Abnormally distributed variables were log-transformed into normal distributed variables and then analyzed thereafter; data were presented with median.
As shown in Table
The changes of UTP/24 h, urine NAG activity, Ccr, and Scr.
Group |
|
Urine NAG |
UTP/24 h |
Scr |
Ccr |
---|---|---|---|---|---|
N | 8 |
|
|
|
|
D | 9 |
|
|
|
|
F | 9 |
|
|
|
|
B | 8 |
|
|
|
|
Compared with N group, ★
The changes of blood pressure and glucose.
Group |
|
BP |
Blood glucose |
---|---|---|---|
N | 8 |
|
|
D | 9 |
|
|
B | 9 |
|
|
F | 8 |
|
|
Compared with N group, ★
Compared with N and F groups, D group had significant expanded glomerular mesangial matrix, increased cell number, thickened basement membrane, with multiple inflammatory cells infiltrated in interstitial space, dilated renal tubular, and fibrosis in interstitial space. There were mild proliferation of glomerular mesangial matrix, inflammatory infiltration, tubular dilatation, and fibrosis in F and B groups, as shown in Figure
The pathological changes of renal glomerular and interstitial space (×400). (a), (b), (c), and (d) represent N group, D group, F group, and B group, respectively, with HE staining. (a) showed normal tubular; (b) showed tubular dilated and distorted with inflammatory infiltration and fibrosis in renal interstitial space; (c) and (d) showed that the distorted tubular with inflammatory infiltration and fibrosis in renal interstitial were significantly reduced. Blue arrow: tubular dilation; red arrow: inflammatory cell infiltration.
The expression of ROCK1 showed trace in tubular epithelium cells in N group, was enhanced in D group which mainly distributed in dilated renal tubular, and was reduced in F and B groups.
Immunohistochemistry expression (envision ×400). (a), (e), and (i) are for N group; (b), (f), and (j) are for D group; (c), (g), and (k) are for F group; and (d), (h), and (l) are for B group. (a), (b), (c), and (d) are the expression of ROCK1; (e), (f), (g), and (h) are the expression of
As shown in Figure
The protein expressions of p-MYPT1, ROCK1,
Group |
|
p-MYPT1 | ROCK1 |
|
E-Cadherin |
---|---|---|---|---|---|
N | 8 | 0.87 (0.72~0.95) | 0.39 (0.23 |
0.11 (0.06 |
|
D | 9 | 1.32 (0.93 |
0.93 (0.64 |
0.68 (0.57 |
|
F | 9 | 0.86 (0.73 |
0.62 (0.51 |
0.14 (0.08 |
|
B | 8 | 0.93 (0.74 |
0.61 (0.52 |
0.13 (0.08 |
|
| |||||
|
7.37 | 20.94 | 125.26 | 28.15 | |
|
<0.01 | <0.01 |
|
|
Note: compared with N group, ★
The protein expression changes of p-MYPT1, ROCK1, E-cadherin, and
Compared with N group, mRNA expression of ROCK1 in renal cortex was increased in D group. Compared with D group, there was less mRNA expression of ROCK1 in F and B groups, lower than normal, as shown in Figure
The mRNA expression of ROCK1. Compared with N group,
In this study, by treating rats with type 1 diabetic nephropathy with benidipine, a triple channel blocker, and fasudil, a Rho kinase inhibitor, we successfully investigated the effect of benidipine on epithelium-mesenchymal transdifferentiation and its possible mechanism via inhibiting Rho kinase activity. These results were consistent with some previous studies [
Rho protein is a small molecular guanylate binding protein. Rho kinase (ROCK) is a widely studied downstream signaling molecule of RhoA. ROCK directly affects myosin light chain (MLC) or indirectly affects the target subunit of myosin phosphatase (MYPT1) and thus increases the phosphorylation of MLC in plasma and controls the attachment, chemoattractant, contraction, and so forth. Phosphorylated MYPT1 level can be used as a marker of ROCK activation. Fasudil is a ROCK-specific inhibitor and inhibits ROCK activity by competitively combining ATP sites of ROCK catalytic domain [
Recent studies revealed that abnormal activation of ROCK signaling pathway played a very important role in the pathophysiology of all kinds of complications of diabetes [
TCC is a low-voltage activated channel, mainly located in renal efferent arterioles and pacing cells of the heart. Through its strong blocking effects on TCC, benidipine dilates renal afferent and efferent arterioles equally and thus effectively reduces the resistance of renal vessels and intrarenal pressure [
In summary, our study is the first study suggesting that benidipine protects kidney in rats with type 1 diabetes, possibly through its effect of inhibiting Rho kinase activity and thus reducing epithelium-mesenchymal transdifferentiation (EMT). This may guide further animal studies, clinical trials on the importance of benidipine in diabetic EMT development especially in type 1 diabetic, and the possible mechanism involved. From the long run, it may direct the clinical use of benidipine in treating patients with diabetic nephropathy especially those in T1DM.
The authors declared no conflict of interests.
This study was funded by Department of Education of Hubei Province (Q20132803).