Fasting to postprandial transition requires a tight adjustment of insulin secretion to its demand, so tissue (e.g., skeletal muscle) glucose supply is assured while hypo-/hyperglycemia are prevented. High muscle glucose disposal after meals is pivotal for adapting to increased glycemia and might drive insulin secretion through muscle-released factors (e.g., myokines). We hypothesized that insulin influences myokine secretion and then increases glucose-stimulated insulin secretion (GSIS). In conditioned media from human myotubes incubated with/without insulin (100 nmol/L) for 24 h, myokines were qualitatively and quantitatively characterized using an antibody-based array and ELISA-based technology, respectively. C57BL6/J mice islets and Wistar rat beta cells were incubated for 24 h with control and conditioned media from noninsulin- and insulin-treated myotubes prior to GSIS determination. Conditioned media from insulin-treated versus nontreated myotubes had higher RANTES but lower IL6, IL8, and MCP1 concentration. Qualitative analyses revealed that conditioned media from noninsulin- and insulin-treated myotubes expressed 32 and 23 out of 80 myokines, respectively. Islets incubated with conditioned media from noninsulin-treated myotubes had higher GSIS versus control islets
Regulation of insulin secretion is critical for understanding glucose homeostasis under (patho)physiological conditions. Such regulation is particularly complex in the transition from fasting to postprandial state on which its secretion must be tightly adjusted to insulin needs, so tissue glucose supply is assured while hypo- and hyperglycaemia are prevented.
Skeletal muscle plays an active role controlling circulating glucose concentration. On the one hand, this tissue is a major site of insulin-stimulated glucose disposal [
In humans, support for this hypothesis comes indirectly from in vivo studies aimed at assessing the effect of insulin on its secretion [
The notion that a muscle-pancreas crosstalk exists has been fairly accepted [
We also included the determination of 5 proteins in the conditioned media as candidate mediators. We selected IL6, IL8/CXCL8, MCP1/CCL2, fractalkine/CX3CL1, and RANTES/CCL5, which are known to be released from muscle cells [
Human primary myotubes were incubated for 24 h with or without 100 nmol/L insulin [
Skeletal muscle cells were obtained from
Myoblasts were isolated and grown as previously described [
Myotubes were incubated for 24 h with/without 100 nmol/L recombinant human insulin (Sigma-Aldrich) in alpha-MEM, Glutamax supplement, without FBS. At the end of the treatment, conditioned media were collected and stored at −80°C until utilization. Once thawed on ice, conditioned media were centrifuged at
After 24 h with/without 100 nmol/L insulin, total glycogen content was determined using an enzymatic method (amyloglucosidase [Sigma-Aldrich]) and the glucose amount obtained was quantified using a commercial kit (DiaSys “Glucose GOD FS”). All assays were performed in triplicate and were normalized to protein amount (BCA Protein Assay kit, Pierce).
Myotubes were preincubated with glucose- and serum-free alpha-MEM for 90 min and then exposed to DMEM supplemented with D[U-14C]glucose (1
Myotubes were preincubated with glucose- and serum-free alpha-MEM for 90 min. This incubation was followed by a 3-hour incubation with D[U-14C]glucose (1
Lactate was measured in myotube supernatant after 24 h treatment with/without insulin using a commercial kit (Lactate PAP, Biomérieux, France). All assays were performed in triplicate and normalized to protein amount (BCA Protein Assay kit, Pierce).
In conditioned media from myotubes treated for 24 h with/without 100 nmol/L insulin, quantitative determination of 5 a priori selected cytokines/chemokines was performed by using multiplex analysis (Luminex, R&D System for IL6, IL8/CXCL8, RANTES/CCL5, and MCP1/CCL2) or ELISA (for fractalkine/CX3CL1; R&D System).
Further analysis included qualitative determination of 80 proteins through a membrane-based antibody array (C-series AAH-CYT-5, from Raybiotech®). Membranes were revealed using a blot scanner (C-Digit®, LI-COR) and spots densitometry was measured using the Image Studio™ software, following the manufacture instructions.
Male C57BL6/J mice were used for all mouse islets experiments and Wistar rats for all rat beta cells experiments. Animals were housed in a temperature- and light-controlled room and were allowed to consume standard chow and water ad libitum. All mice experiments were carried out in accordance with the National Research Council (NRC) Publication Guide for Care and Use of Laboratory Animals (copyright 1996, National Academy of Science) and approved by the Ethics Committee for Animal Welfare from the School of Medicine of the Pontifical Catholic University of Chile. Rat experiments were carried out according to protocols approved by the State Commissioner on Animal Care. Adult 8-week old mice and 150–200 g rats were anesthetized with a mix of ketamine: xylazine (0.18 mg : 0.012 mg per gram of animal) by intraperitoneal injection. Pancreas was perfused with collagenase (0.21 mg/mL of Liberase TL [Roche] for mice and 0.90 mg/mL of collagenase [Sigma] for rats) through the common bile duct prior to euthanasia (by incision of the chest cavity to produce a bilateral pneumothorax). After verification of death, pancreas was removed out of the animal. Islets were isolated after pancreas digestion (37°C for 14 min), followed by Histopaque® 1077 (Sigma) density gradient separation and handpicked purification. Mice islets were cultured until the next day in RPMI 1640 medium containing 11.2 mmol/L glucose, 10% FBS, 110
Mice islets (5 per condition) and rat beta cells were incubated for 24 h with (i) unconditioned (control) media; (ii) conditioned media from noninsulin-treated myotubes; (iii) conditioned media from insulin-treated myotubes; and (iv) unconditioned (control) media with 100 nmol/L recombinant insulin. All media were supplemented with 10% SBF prior to islet or beta cell incubation.
After 24 h incubation, mice islets and rat beta cells were washed for one or two hours (resp.) by incubating with Krebs Ringer HEPES buffer (KRH in mmol/L: 137 NaCl, 4.8 KCl, 1.2 KH2PO4, 1.2 MgSO4, 2.5 CaCl2, 5 NaHCO3, 16 HEPES, and 0.1% BSA) at 2.8 mmol/L glucose, and supernatant was eliminated. Then, mice islets and rat beta cells were incubated for one hour with KRH 2.8 mmol/L glucose (basal insulin secretion) followed by one-hour incubation at 16.7 mmol/L glucose (i.e., GSIS). All incubations were performed at 37°C and 5% CO2. Supernatants were collected, while islets and beta cells were lysed in HCl-Ethanol. Supernatants and lysates were stored at −20°C for insulin determination. For mice islets, insulin was determined by ELISA (Merck-Millipore) by RIA for rat beta cells. Insulin secretion is expressed as a percentage of the total content. All experiments were run in triplicate.
Two independent pools of at least 400 islets were obtained from ~10 mice each. Islets were incubated overnight in complete RPMI 1640 medium as described above and stored at −80°C in lysis buffer with 1% 2-mercaptoethanol (Life Technologies) for later extraction and analysis. Total RNA was isolated using the PureLink™ RNA Mini Kit (Life Technologies), treated with DNase (on column PureLink DNAse, Life Technologies), and quantified with a Nanodrop 2000 spectrophotometer (Thermo Scientific). cDNA was synthesized with the AffinityScript QPCR cDNA Synthesis Kit (Agilent Technologies), using 500 ng total RNA in a 20
Sequences of forward and reverse primers used for PCR analyses.
Gene | Forward | Reverse | Product length (bp) |
---|---|---|---|
| atccaccttgaattctcccatc | gcctcactttcttccagttca | 145 |
| cctctgacttccatttctgct | caagaatcctcgtccatgtcc | 118 |
| tcccgtgatatttccaaattctttc | tcccgcacacaaggaac | 120 |
| ggtgcccactcatattcatagg | ctactggactcataaaggacttagc | 125 |
| gtgctgacataccataatcgatg | tgtcttcatgttagatttgtacagc | 147 |
| aggaactggtcaggaataatagc | caaaggcccagaaacaaagtc | 125 |
| tcaggatctcagctcacaga | agatagggtcactactgcga | 102 |
| actgaggtaacatattattgtcttcca | gagccatacctgtaaatgcca | 148 |
| cacaatgtcgcccaaataacag | tcccttcccatctgctca | 112 |
| tggagagcaccaagacagaca | tgccggagtcgacaatgat | 66 |
Unless stated otherwise, all data are expressed as mean ± SEM of multiple experiments. All statistical comparisons were done by two-tailed
As expected, insulin increased myotubes glycogen content after 24 hours by 1.6 ± 0.3-fold
Myotubes metabolic changes in response to insulin. Glycogen content (a) and extracellular lactate content (d) were determined after 24 h with/without 100 nmol/L insulin treatment. Glycogen synthesis (b) and glucose oxidation (c) were determined after 3 h incubation with D[U-14C]glucose with/without 100 nmol/L insulin. Mean ± SEM.
Conditioned media from noninsulin-treated and insulin-treated human myotubes showed less than 10% cell mortality relative to the cell lysate positive control (Figure
Myotube death in conditioned media from noninsulin- and insulin-treated myotubes. Cell death was assessed by chemiluminescent quantification of adenylate kinase activity normalized to total protein content. RLU, relative light units. Mean ± SEM.
Myokine expression in conditioned media from noninsulin- and insulin-treated myotubes. IL6 (a), IL8/CXCL8 (b), MCP1/CCL2 (c), and RANTES/CCL5 (d) determined by multiplex in myotube-conditioned media from noninsulin- and insulin-treated myotubes. Mean ± SEM. Analysis by two-tailed
Mice islets incubated with control media (with or without added recombinant insulin) or myotube-conditioned media (from noninsulin- and insulin-treated myotubes) had similar basal insulin secretion (Figure
Effect of conditioned media from noninsulin- and insulin-treated myotubes on glucose-stimulated insulin secretion. Insulin secretion in isolated mice islets (a) and primary rat beta cells (b). Islets and beta cells were incubated with conditioned media from nontreated and insulin-treated myotubes for 24 h before hormone secretion assessment. Controls are unconditioned media without/with added insulin (100 nmol/L). Low glucose = 2.8 mmol/L glucose and high glucose = 16.7 mmol/L glucose. Mean ± SEM.
Gene expression of selected myokine receptors was determined in isolated mice islets (receptor’s and their ligands are listed in Table
Cytokines/chemokines receptors name and its ligands.
Receptor name | Ligand |
---|---|
IL6R | IL6 |
CXCR1 | IL8/CXCL8 GRO/CXCL1,2&3 NAP2/CXCL7 |
CXCR2 | IL8/CXCL8 GRO/CXCL1,2&3 |
CCR3 | RANTES/CCL5 |
CCR5 | RANTES/CCL5 |
CCR1 | RANTES/CCL5 |
GPR75 | RANTES/CCL5 |
CCR2 | MCP1/CCL2 |
CX3CR1 | Fractalkine/CX3CL1 |
mRNA expression of myokine receptors in mouse islets. Quantification of myokine receptors mRNA in ~400 pooled islets expressed as a percentage of cyclophilin mRNA levels in the same samples. Mean ± SEM.
We found that human myotubes-derived media increased GSIS in isolated mice islets, whereas such effect was not observed in rat primary beta cells. In turn, conditioned media of insulin-treated myotubes did not change GSIS, both in isolated pancreatic islets and beta cells, when compared with control condition. Previously, Bouzakri et al. [
Our hypothesis that skeletal muscle interacts with pancreas regulating insulin secretion is mostly grounded on the classical inverse association between insulin sensitivity and its secretion [
Human myotubes conditioned media expressed 32 out of 80 detectable proteins. Apparently, none of the most highly expressed myokines (GRO/CXCL1, 2, and 3, MCP1/CCL2, IL8/CXCL8, TIMP1, TIMP2, NAP2/CXCL7, and ENA-78/CXCL5) according to our qualitative approach seemed to play a role in insulin secretion, considering that their receptors in isolated pancreatic islets showed undetectable mRNA expression under cultured conditions (i.e., RPMI 1640 at 11.2 mmol/l glucose). Certainly, alternative myokines as well as nonprotein factors may underlie our finding.
In this regard, a nonprotein factor representing a new cell-to-cell communication mode comes from exosomes. These are microvesicles carrying molecules such as microRNA that can reach distant organs and exert a (patho)physiological effect. Indeed, a recent study showed that skeletal muscle cells-derived exosomes when injected to mice targeted beta cells [
Additional interest was focused on the role of insulin on myokine secretion and then the effect of conditioned media from insulin-treated myotubes on GSIS. As observed for other conditions (e.g., muscle contraction-induced glycogen depletion increases muscle IL6 secretion [
Thus, we observed that an increase in glycogen synthesis/content was accompanied by reduced IL6 concentration in conditioned media of insulin-treated human myotubes. Eventually, IL6 and additional myokines may mediate the well-known inverse association between insulin sensitivity and its secretion [
In part, insulin induced only minor changes in myokine secretion and GSIS from islets incubated with nonconditioned media and conditioned media from insulin-treated myotubes was similar. It cannot be ruled out that 24 h insulin exposure (100 nmol/L) may have impaired muscle cell insulin sensitivity and altered any insulin-dependent difference in the pattern of myokine secretion. Thus, some factors might be mostly released during the period of preserved insulin sensitivity, and then their release will be altered as insulin resistance develops. Even so, those factors should still be found in the media independent of the change over time in their secretion pattern. It is also possible that the myokine concentration at which islets were exposed may have been insufficient to influence GSIS. Furthermore, our model based on different species (human myotube-conditioned media and murine islets/beta cells) may add complexity to interpretation. Still, an earlier study found comparable results when rat and human beta cells were treated with conditioned media from human myotubes [
Taken together, these findings support the hypothesis that skeletal muscle-released factors can influence insulin secretion, which encourages the quest for identifying the nature of such factor as well as its potential in vivo role on glucose homeostasis. Any eventual physiological relevance of our findings appears independent of insulin and its action in muscle, at least under the context of our study. Thus, a mechanism mediating the interaction between insulin sensitivity and its secretion remains uncovered.
The authors declare that there is no conflict of interests associated with this manuscript.
Maria Luisa Mizgier and Jose E. Galgani designed the study, analysed and interpreted the data, and drafted/revised and approved the final version of the manuscript. Luis Rodrigo Cataldo analysed qRT-PCR, interpreted the data, and revised and approved the final version of the manuscript. Juan Gutierrez, José L. Santos, Ariel E. Contreras-Ferrat, Paola Llanos, and Mariana Casas interpreted the data and revised and approved the final version of the manuscript. Cedric Moro collaborated in the generation of myotube-conditioned media, interpreted the data, and revised and approved the final version of the manuscript. Karim Bouzakri collaborated in the primary beta cells experiments, interpreted the data, and revised and approved the final version of the manuscript.
This work was supported by FONDECYT 1130217 (to Jose E. Galgani); National Research Agency ANR-12-JSV1-0010-01 (to Cedric Moro); Swiss National Science Foundation 31–135 645 (to Karim Bouzakri); Young Independent Investigator Grant from Swiss Society for Endocrinology and Diabetes (to Karim Bouzakri); P. Universidad Católica de Chile PhD Fellowship (to Maria Luisa Mizgier); Albert Renold Travel Fellowships (to Maria Luisa Mizgier).