Diabetes is a common chronic disease with enhanced glucose levels occurring in the long term, which have an impact on the body and exert a number of negative effects [
Phosphoinositide 3-kinase (PI3K) may induce endothelial cell migration and proliferation in endothelial cells through manifold signaling pathways. PI3K-protein kinase B (Akt) signaling pathways may be a potential therapeutic method. When the oxidative stress links postprandial hyperglycaemia with endothelial dysfunction, patients with diabetes may present raised oxidant and reduced antioxidant levels [
Endothelial cells are a key target for diabetic vascular disease. Numerous studies have demonstrated that obesity, insulin resistance, and type 2 diabetes are associated with abnormal endothelial function and participate in the occurrence and development of diabetes mellitus and small vascular complications [
Male Wistar rats (
L-Nitro-arginine-methyl-ester (L-NAME) was purchased from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany; batch no. N5751-10), and sodium pentobarbital was purchased from Shanghai Chemical Reagent Co., Ltd. (Shanghai, China). Anti-HIF-1 alpha antibody, anti-PTEN antibody, anti-VEGFA antibody, anti-PI3K p85 antibody, anti-PI3K p85 (phospho Y607) antibody, and anti-AKT1 (phospho S473) antibody were purchased from Abcam (batch no. Ab1; ab32199; ab1316; ab86714; ab182651; ab81283; dilution 1 : 200; 1 : 100; 1 : 100; 1 : 100; 1 : 200; 1 : 200); TRIB3 polyclonal antibody, AKT (L321) polyclonal antibody, and AKT (phospho-T308) polyclonal antibody were purchased from Bioworld (batch no. BS60451; BS1502; BS4647; dilution 1 : 100; 1 : 100; 1 : 100).
All rats were allowed
Human umbilical vein endothelial cells were cultured in RPMI-1640 medium (Thermo Fisher Scientific, Inc., Waltham, MA, USA) with 10% fetal bovine serum and 1% penicillin/streptomycin (Sigma-Aldrich; Merck KGaA). Cells were incubated under 5% CO2 at 37°C; normal medium was 5.5% glucose.
The cell seed plate was treated with drug addiction according to the experimental scheme, and the concentration of each sample was set to 3-5 replications. 20 milliliters of l MTT solution (5 mg/ml, i.e., 0.5% MTT) was added to all holes and incubated in the incubator for 4 hours. Carefully remove the supernatant and add DMSO (dimethylsulphoxide) at 150 milligrams per well for 10 min at low speed (120~140 rpm/min) in the shaking table for full dissolution of the crystals. The absorptive value of 490 nm was measured using an enzyme labelling machine, and the inhibition rate of the drug on cells was calculated according to the formula.
Systolic blood pressure, diastolic blood pressure, mean blood pressure, and heart rate of the rats were monitored using a tail blood pressure measuring instrument, and the mean blood pressure of each animal was measured three times.
A right lobe of each aorta abdominalis tissue from each rat was fixed in 10% neutral formalin and stained with hematoxylin and eosin (H&E), Masson, and Verhoeff staining for histological examination.
Initially, subsequent to drying, the cells were evenly distributed in the center of the cover glass with a group pen; 50-100
TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) was used to isolate and purify total RNA according to the manufacturer’s protocol. The quantity and quality of the RNA samples were determined using the NanoDrop 2000 instrument (Thermo Fisher Scientific, Inc.). The RNA integrity was assessed by electrophoresis with denaturing agarose gel.
RT-qPCR was performed using a fluorescence quantitative PCR instrument (ABI 7300) according to the manufacturer’s protocol.
Real-time quantitative PCR primer sequence.
Gene name | GeneBank ID | Sense primer | Antisense primer | Product length |
---|---|---|---|---|
Akt | NM_005163 | GCACAAACGAGGGGAGTACAT | AGCGGATGATGAAGGTGTTGG | 192 |
PI3K | NM_181523 | ACCACTACCGGAATGAATCTCT | GGGATGTGCGGGTATATTCTTC | 207 |
PENT | NM_000314 | AGGGACGAACTGGTGTAATGA | CTGGTCCTTACTTCCCCATAGAA | 100 |
VEGF | NM_001171627 | AGGGCAGAATCATCACGAAGT | AGGGTCTCGATTGGATGGCA | 75 |
ACTA | NM_001101 | CATGTACGTTGCTATCCAGGC | CTCCTTAATGTCACGCACGAT | 250 |
Cells were scraped and lysed in RIPA buffer (cat no. P0013B; Beyotime Institute of Biotechnology, Haimen, China), and proteins were measured with a bicinchoninic acid protein assay kit (cat no. P0010; Beyotime Institute of Biotechnology). The primary antibodies used in the experiments are as follows: Akt (cat no. BS2987, 1 : 500; Bioworld Technology, Inc., St. Louis Park, MN, USA), VEGF (cat no. ab1316, 1 : 150; Abcam, Cambridge, UK), phosphatase and tensin homolog (PTEN; cat no. ab32199, 1 : 500; Abcam), and
Experimental data were presented as the
MTT data showed that high glucose has inhibited cell activity (Table
MTT cell experiment data.
Group | OD average (24 h) | OD average (48 h) | Inhibition ratio (24 h) | Inhibition ratio (48 h) |
---|---|---|---|---|
Normal HUVEC | 0.87 | 1.17 | — | — |
30 mM high glucose group | 0.84 | 0.94 | 0.03 | 0.19 |
5.5 mM |
0.84 | 0.94 | 0.03 | 0.20 |
5% drug serum | 0.85 | 1.06 | 0.03 | 0.09 |
10% drug serum | 0.81 | 0.92 | 0.07 | 0.21 |
15% drug serum | 0.78 | 0.81 | 0.11 | 0.31 |
20% drug serum | 0.68 | 0.73 | 0.22 | 0.38 |
25% drug serum | 0.62 | 0.54 | 0.29 | 0.54 |
30% drug serum | 0.53 | 0.50 | 0.39 | 0.57 |
The heart rate results in the rats revealed that the heart rate of the GK control group was significantly higher compared with in the Wistar control group (
Additionally, diastolic blood pressure in the GK control group was significantly higher when compared with that of the Wistar control group (
The SBP, DBP, MBP, and HR of rats (,
Wistar control group | GK control group | GK experimental model group | |
---|---|---|---|
SBP | |||
DBP | |||
MBP | |||
HR |
Note: compared with the control group,
H&E staining revealed that the rats in the Wistar control group presented with a flat abdominal aorta intima and flat endothelial cells, clingy on flat in elastic plate, neatly and elastic plate with smooth muscle cells in parallel arrangement, intimal smooth and tidy. Compared with the control group, there was thickening and breakage of the intima, the endothelial cells were partially detached, swollen, and infiltrated in the rats in the GK experimental model group. Additionally, the smooth muscle cells of the medium membrane had undergone hypertrophy, were distorted, and had an arranged disorder, and the number of layers was increased (Figure
Histological examination of the aorta abdominalis tissue of type 2 diabetes mellitus in rats (magnification ×200). (a) H&E staining; (b) Masson staining; (c) Verhoeff staining; A: Wistar control group; B: GK experimental model group. 1: endothelium cells; 2: swollen and infiltrated endothelium cells; 3: media thickness; 4: collagen fibers; 5: peritubular collagen fibers; 6: elastic fibers; 7: elastic fiber fracture.
Masson staining revealed that the aortic smooth muscle cells and elastic fibers were dyed red and the collagen fibers were blue-green. Rats from the Wistar control group demonstrated that the collagenous fibers of the abdominal aorta wall are evenly distributed and are slender and the adjacent cells have a good network of collagen fibers. The fibrosis of the vessels was very light. Compared with the control group, the collagenous fibers of the abdominal aorta were increased, and the collagen fibers were interlinked into nets or clumps and arranged in a disordered and unevenly distributed manner, tightly surrounding the smooth muscle cells in the rats of the GK experimental model group (Figure
Verhoeff staining revealed that the membrane elastic fibers in the aorta were black or blue-black and the smooth muscle fibers and collagen fibers were red. Rats from the Wistar control group revealed that the abdominal aorta elastic fiber distribution was uniform, neat, and complete without fracture. Compared with the control group, the abdominal aorta elastic fibers were circular, the arrangement was loose, the distribution was unevenly distributed, and the visible fracture was notable in the rats of the GK experimental model group (Figure
Under a confocal microscope, the expression of VEGF, PTEN, PI3K, and Akt in the cells produced blue fluorescence; VEGF in the control group cells produced comparatively weak fluorescence and an enhanced fluorescence intensity in the high-sugar stimulus group. The PI3K and Akt expression in the control group cell demonstrated weak fluorescence and enhanced fluorescence intensity in the high-sugar stimulus group. PTEN in the control group cell demonstrated strong fluorescence, and the fluorescence intensity of the high-sugar stimulus group was comparatively weak (Figures
Immunofluorescence analysis of HUVEC cells (magnification ×200). (a) VEGF; (b) AKT; (c) PI3K; (d) PTEN; A: control group cell; B: high-sugar stimulus group.
The relative expression of VEGF, AKT, PI3K, and PTEN in immunofluorescence analysis. Compared with the control group,
The amplification curve revealed that in the present study, the reaction curves of PTEN, Akt, PI3K, and VEGF were substantial, and these exhibited high efficiency rates and good parallelism of amplification curve. Additionally, a repeated reaction produced a similar level of amplification, demonstrating the efficiency, repeatability, and accuracy of this experiment. The low concentration curve index period is obvious, not easy to appear false masculine misjudgment, and had high sensitivity. The melting curve revealed a curve with a single peak, indicating that the amplification product was pure. The product length met the design requirements, indicating that the Cq value produced was accurate.
RT-qPCR revealed that PTEN mRNA expression levels in the high-sugar stimulus group were significantly lower compared with the control group (
The expression of VEGF, AKT, PI3K, and PTEN mRNA in HUVEC cells. Compared with the control group,
Western blot analysis revealed that the protein expression levels of PTEN in the high-sugar stimulus group were significantly lower compared with the control group (
Western blot analysis of VEGF, AKT, PI3K, and PTEN protein (a). The expression of VEGF, AKT, PI3K, and PTEN protein in HUVEC cells (b). Compared with the control group,
GK rats are internationally recognized nonobesity type 2 diabetes mellitus animal models with the following characteristics: lower glucose-stimulated insulin secretion, excessive liver sugar production, and muscle and adipose tissue medium insulin resistance [
Vascular endothelial cells are highly differentiated monolayer cells which cover the surface of the vascular lumen and serve important functions including regulating vascular permeability, maintaining blood flow, and regulating vascular smooth muscle cell proliferation. Endothelial cell apoptosis may increase smooth muscle cell proliferation and migration, enhance blood coagulation, and increase leukocyte infiltration into the endothelium thus leading to endothelial dysfunction [
VEGF is a glycosylated mitogen that specifically affects endothelial cells and has various effects, including mediating increased vascular permeability, inducing angiogenesis, vasculogenesis, and endothelial cell growth, promoting cell migration, and inhibiting apoptosis [
PTEN is a tumor suppressor which is mutated in a number of different cancer types at a high frequency. Phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase is encoded by this gene. This protein dephosphorylates phosphoinositide substrates unlike other protein tyrosine phosphatases [
Angiogenesis is a tyrosine kinase and its ligand signals through a complicated endothelial molecular system, and this ligand signaling system regulates the endothelial cell function, including endothelial cell proliferation, migration, and capillary formation [
In the present study, the fluorescence intensity of Akt and PI3K in the high-sugar stimulus group was stronger compared with the control group, and that of PTEN in the high-sugar stimulus group was weaker compared with the control group. Akt and PI3K mRNA and protein expression in the high-sugar stimulus group were higher compared with the control group, and that of PTEN mRNA in the high-sugar stimulus group was lower compared with the control group. These results illustrate that PTEN serves a negative regulatory role in the development of novel blood vessels and may inhibit the PI3K/Akt signaling pathway. It inhibits the formation and development of the pathological neovascularization of an atheromatous plaque.
In summary, when vascular disease occurred in type 2 diabetes rats, the expression of VEGF in the aortic tissue was increased, the expression of PTEN was decreased, and the activity of the PI3K/Akt signaling pathway was decreased. Excessive proliferation of vascular endothelial cells is a common model in diabetic vascular disease. Therefore, inhibiting excessive proliferation of vascular endothelial cells is conducive to the effective control of diabetic vascular disease. This study furthered the understanding of the mechanisms of type 2 diabetes and produced a potential method for future disease treatment studies, which may contribute to the development of novel diagnostic markers and therapeutic targets for the clinic treatment of type 2 diabetes. However, there were still some limitations in the current study. Glucose metabolism is mainly detected when insulin resistance mechanism is performed, while we focus on vascular lesions, so nevertheless, further experiments are required to validate their effects in type 2 diabetes. At the present stage, we mainly want to explain the mechanism of damage to large vessels, especially endothelial cells in the process of diabetes. We are also designing and carrying out the mechanism of the regulation of angiogenesis by antihypertensive drugs.
The data used to support the findings of this study are available from the corresponding author upon request.
The authors declare that they have no conflicts of interest.
JR G conceived and designed the study. NN J, LP H, and MF G performed the experiments. XJ Q wrote the paper. H J, ZH F, and L S reviewed and edited the manuscript. All authors read and approved the manuscript.
This study was financially supported by Science Foundation Projects of Anhui University of Traditional Chinese Medicine (2014qn018) and the second batch of scientific research projects of the national TCM clinical research base of the State Administration of Traditional Chinese Medicine (JDZX2015126). We are grateful to Mr. Qiang Fan (Ao Ji Bio-tech Co., Ltd., Shanghai, China) for providing help in data analysis.