Cellulose nanocrystals (CNCs) have emerged as promising materials for the fabrication of micro/nanoplatforms that can replace tissues more effectively. CNCs offer interesting properties that facilitate the enhancement of polymer properties. Cytotoxicity of rice husk-derived CNCs was evaluated through WST-1 assay in the presence of human mesenchymal stem cells. Electrospinning technique was used to fabricate nanofibers of poly-
Various materials have been utilized to fabricate scaffolds as an extracellular matrix (ECM) for tissue engineering [
Schematic representation of fabrication of PCL/CNC composite fiber through the electrospinning process.
Rice husk powder was prepared by the mill (A10, IKA, Germany). To remove the silica content, the rice husk powder (10 g) was stirred with 3% (
Fourier-transform infrared (FTIR; Frontier, Perkin Elmer, UK) spectra of the chemically treated and untreated rice husk were obtained in transmission mode with 16 scans. FTIR measurements were taken in the wavenumber range of 500-4000 cm-1 at a resolution of 4 cm-1. The thermal stability of the extracted CNCs was evaluated by using thermogravimetric analyzer (TGA) in the range of 40-500°C with a heating rate of 10°C/min (SDT Q600, TA Instruments, USA). The dimensions (including its shape and size distribution) of the CNCs were measured by transmission electron microscopy (TEM; JEM 2100F, Jeol, Japan). For this, the CNCs were dispersed in deionized water by sonication. A drop of diluted CNC aqueous suspension was deposited on a microgrid and air-dried for 30 min. The grid was negatively stained with uranyl acetate and air-dried. The dimensions of the CNCs were measured by ImageJ (Version 1.8.0., NIH Portal, Maryland, USA).
Polycaprolactone (PCL; ≥95%, Sigma-Aldrich, USA; CAS: 24980-41-4) with an average molecular weight of 80,000 g/mole was used for preparing the PCL/CNC composites. PCL was dissolved in dimethylformamide (DMF; Daejung, Republic of Korea; CAS: 68-12-2) to obtain a 15 wt.% solution. Different amounts of CNCs (e.g., 0.5%, 1%, and 2%) were blended with PCL. For electrospinning, PCL/CNC solution was loaded into a 10 cm3 plastic syringe. The solution was delivered at a constant flow rate to a high voltage power supply to make the PCL/CNC nanofibers. When a high voltage (18.0 kV/cm) was applied, a Taylor cone jet with a flow rate of 2 ml/h was ejected from the tip of the syringe.
Scanning electron microscopy (SEM) was used to evaluate the 2D morphology of the electrospun nanocomposites. For SEM observation, all the materials (PCL, PCL/CNC0.5, PCL/CNC1, and PCL/CNC2) were sputter-coated with platinum and observed by field emission-SEM (FE-SEM; Hitachi S-4800, California, USA) with an acceleration voltage of 5.0 kV/cm. The morphology of the electrospun nanocomposites is given in Figure
FE-SEM morphologies of the fabricated nanofibers of PCL and indicated composites.
The mechanical properties of the fabricated scaffolds were evaluated through a tensile test. The tensile testing was carried out in a universal testing machine (UTM; MCT-1150, AND Inc., Japan). The test was performed using a constant speed of 10 mm/min. All the samples were prepared in triplicate.
The human bone marrow-derived mesenchymal stem cells (hMSCs) were obtained from the Korean Cell Line Bank (KCLB, Seoul, Republic of Korea). Cell culture was carried out using Dulbecco’s modified Eagle’s medium (DMEM; WELGENE, Republic of Korea; CAS: LM-001-05) with 10% fetal bovine serum (FBS; WELGENE, Republic of Korea; CAS: S-101-101) and the antibiotic-antimycotic mixture (Anti-Anti; 100X, Gibco, USA; CAS: 15-240-062) containing penicillin (10,000 units/ml), streptomycin (10,000
The fabricated PCL/CNC composites at different CNC concentrations (e.g., 0% CNC, 0.5% CNC, 1% CNC, and 2% CNC) were added into wells of a 24-well plate and incubated at 37°C with 5% CO2 (Steri-Cycle 370 Incubator; Thermo Fisher Scientific, USA). The hMSCs (
To study the cell-matrix interaction of hMSCs with fabricated scaffolds, scanning electron microscopy (SEM) was performed. Samples were prepared by a modified protocol described by Lee and Chow [
Enhanced osteogenic activity of fabricated PCL/CNC composites in the presence of hMSCs was measured by ARS staining (Sigma-Aldrich, USA; CAS: 130-22-3) after 7 and 14 days of incubation. The media were replaced every 3 days. Passage 4 cells were used for cell seeding. After cell culture, the hMSCs were fixed in 4% formalin for 15 min, rinsed with distilled water, and stained with 40 mM alizarin red S (pH 4.2) stain. The mineralization was documented using an optical microscope (Zeiss, USA). Excess dye was removed by washing the plates with deionized water four times. The remaining dye was dissolved in 500
To study the gene expression in both PCL/CNC composites and control samples, cells were seeded in a
Specified primer sequences used for quantitative real-time PCR (qRT-PCR).
Gene | Sequences (5 |
---|---|
GGCTATAAGTTCTTTGCTGACCTG | |
CGCATTCCTCATCCCAGTAT | |
TGCTTGAGGAGGAAGTTCAC | |
CTGACCTTCCTGCGCCTGATGTCC | |
GTGCAGAGTCCAGCAAAGGT |
HPRT: hypoxanthine-guanine phosphoribosyl transferase; RUNX2: Runt-related transcription factor 2; OSX: Osterix; COL1: collagen type 1; OCN: osteocalcin.
Statistical analysis was performed using SAS for Windows v8.2 (SAS Institute., Cary, NC, USA). Statistical significance between the control and treatment groups was determined using ANOVA, Duncan’s multiple range test, and Mann-Whitney rank sum tests. All the data are presented as
The FTIR spectra of rice husk before and after purification are given in Supplementary Figure
It is well known that cleavage of the glycosidic linkage of the cellulose structure occurs in the presence of an acidic environment. These cleavages of the glycosidic linkage are responsible for the generation of nanodimensional cellulose moieties known as nanocellulose. Figure
(a) TEM images of rice husk-derived CNCs and (b) length and width distribution histogram of sulfuric acid hydrolyzed CNCs.
The mechanical properties of fabricated composites under uniaxial stress (stress-strain curve) through a universal tensile machine (UTM) are given in Figure
The mechanical properties of the fabricated scaffolds. (a) The strain-stress curve and (b) the bar diagram representation of peak stress values of different PCL/CNC composites under uniaxial tensile test.
For biomedical applications, the material should be nontoxic and biodegradable. Also, the material should not elicit any kind of adverse immune response in surrounding conditions. Cell viability of the fabricated scaffolds was evaluated by the WST-1 assay technique in the presence of hMSCs after 14 days of incubation (Figure
Cytotoxicity evaluation of the pure PCL and indicated composite nanofibers in the presence of hMSCs at indicated time intervals (
Evaluation of osteogenic differentiation potential of hMSCs in the presence of the pure PCL and indicated composite after 7 and 14 days of treatment. (a) ARS staining of cultured hMSCs along with corresponding optical images in the presence of the pure PCL and indicated composite. (b) Mineralization study after 7 days and 14 days of incubation. The medium without sample was used as control.
Proper adhesion onto the extracellular matrix (ECM) is important for viability and proliferation of hMSCs. Thus, surface modification using various scaffolds is a promising strategy for bone engineering [
FE-SEM morphologies of hMSCs cultured on the surface of pure PCL and indicated composite nanofibers.
Real-time PCR was performed to evaluate the differentially expressed genes during osteogenesis. The levels of the differentiation-specific genes in the presence of 2% PCL/CNC scaffolds were evaluated by qRT-PCR after 7 and 14 days of incubation (Figure
Real-time PCR (qRT-PCR) analysis for the expression of osteogenesis-specific genes (RUNX1, OSX, OCN, and COL1) in the presence of 2% PCL/CNC composites after 7 and 14 days of incubation (
In this study, we evaluated the synergistic effects of the PCL/CNC composites in terms of mechanical properties, cell viability, and induction of osteogenesis. The CNCs were extracted from rice husk biomass and characterized by the TEM. No significant cytotoxicity was exhibited by the obtained CNCs. A significant improvement in mechanical properties occurred in the fabricated scaffolds indicating the more significant interactions between PCL and CNCs. In addition, the cell viability enhanced in the presence of the fabricated nanofibers indicating their biocompatibility. Importantly, significant mineralization of the hMSCs occurred when the CNC content of the scaffolds was high (2%) indicating that the hMSCs were induced to undergo osteogenesis by synergistic effects. Moreover, the RUNX2 and OCN expressions were also upregulated in the presence of 2% PCL/CNC composites. On the basis of these results, we concluded that the fabricated nanofibers can serve as a biomaterial for tissue engineering applications. We hope that this approach for fabrication of PCL/CNC-based composites will open a new direction in tissue engineering.
The data used to support the findings of this study are available from the corresponding author upon request.
The authors declare no conflict of interest.
Sayan Deb Dutta and Dinesh K. Patel contributed equally to this work.
This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (No. 2018R1A6A1A03025582 and No. 2016R1D1 A3B03932921). The authors also acknowledge the Cooperative Research Program for Agriculture Science and Technology Development (No. PJ012854012017), Rural Development Administration.
Supplementary Figure 1: the photograph of the (a) pure rice husk, (b) the chemically treated samples, and (c) CNC suspension, isolated from rice husk. Rice husk powder (10 g) was used for the generation of CNCs. The extracted CNCs were lyophilized and stored in a sealed container prior to use. Approximately 2.9 g CNC was regenerated from 10 g of pure rice husk. Supplementary Figure 2: spectroscopic characterization of pure rice husk and the chemically treated sample: (a) FTIR spectra, (b) TGA thermograms, and (c) SEM morphology (i and ii) of pure rice husk and the chemically treated sample showing the roughness before and after treatment. Both the samples exhibited a similar kind of degradation pattern, starting at 252°C and 375°C as indicated in TGA analysis. However, early-stage (~100°C) degradation was due to the moisture. The disappearance of the 800 cm-1 peaks from the chemically treated rice husk indicates the removal of the silica functional group as shown in FTIR spectra. Supplementary Figure 3: cell viability data of hMSCs in the presence of different CNC concentrations after 24 and 48 h of incubation and is evaluated by WST-1 assay. Results were represented as percentage of triplicate experiments (