Tramadol is a synthetic, centrally acting analgesic. It is the most consumed narcotic drug that is prescribed in the world. Tramadol abuse has dramatically increased in Egypt. Long term use of tramadol can induce endocrinopathy. So, the aim of this study was to analyze the adrenal insufficiency induced by long term use of tramadol in experimental animals and also to assess its withdrawal effects through histopathological and biochemical genetic study. Forty male albino rats were used in this study. The rats were divided into 4 groups (control group, tramadol-treated group, and withdrawal groups). Tramadol was given to albino rats at a dose of 80 mg/kg body weight for 3 months and after withdrawal periods (7–15 days) rats were sacrificed. Long term use of tramadol induced severe histopathological changes in adrenal glands. Tramadol decreased the levels of serum cortisol and DHEAS hormones. In addition, it increased the level of adrenal MDA and decreased the genetic expression of glutathione peroxidase and thioredoxin reductase in adrenal gland tissues. All these changes started to return to normal after withdrawal of tramadol. Thus, it was confirmed that long term use of tramadol can induce severe adrenal insufficiency.
Tramadol Hydrochloride (Tramal™) is a synthetic centrally acting analgesic drug with opioid and nonopioid properties. It is used parenterally and orally for the treatment of moderate to severe pain due to its relatively lower risk of respiratory depression or physical dependence and better safety profile when compared with other opiates [
The molecular formula of tramadol is C16H25NO2. It is rapidly absorbed after oral administration and its peak blood level is achieved about 2-3 hours thereafter. Its half-life is about 5-6 hours and it is metabolized in liver by demethylation. Its active metabolite (O-desmethyltramadol) has a higher affinity for the mu-opioid receptors and twice the analgesic effect of the parent drug [
The most common adverse effects of tramadol are nausea, vomiting, dizziness, anorexia, seizures, and hypotension which may occur in therapeutic or toxic doses [
Recently, young adult addicts “typically substituted tramadol for heroin.” Repeated tramadol administration in such patients might lead to accumulation of toxic metabolites in their blood and thus increase its potential for toxicity [
There is a recent study that revealed that about 40% of temporary cleaners and 21% of permanent cleaners working in governmental hospitals in Zagazig city in Egypt used tramadol. A recent governmental investigation of 1800 truck and microbus drivers found that 200 (11%) of them admitted to regular usage of drugs when working. Also, tramadol abuse is associated with 18.7% of death rates due to road traffic accidents [
Many researchers have explored and evaluated the effects of chronic use of tramadol on many organs, for example, liver, kidney, testes, heart, and thyroid gland. Owing to the few number and scanty data in the evaluation of the effects of chronic use of tramadol on the endocrine system, the objective of this study was to analyze the adrenal insufficiency induced in albino rats by chronic use of tramadol and its withdrawal effects.
This study was carried out on 40 adult male Wistar albino rats (weighing approximately 200–250 gm body weight) of 12 weeks of age. These rats were obtained from Minia University laboratory animals growing center in Minia, Egypt. They were housed in plastic cages and fed a standard laboratory diet (ad libitum) and water during the experimental period. All rats were kept under good ventilation and aerated room at a laboratory temperature of
Tramal (Tramadol HCL), 50 mg tablets, was obtained from Memphis for Pharmaceutical and Chemical Industries, Egypt. It was dissolved in water and according to the study of “Matthiesen et al. [
This experimental work was done in the departments of Forensic Medicine & Clinical Toxicology, Biochemistry, and Histology, in Faculty of Medicine, Minia University, Egypt, during the period from 1 January to the end of March 2017. Animals were divided into 4 groups (10 rats for each group) as follows: Group I (control group): the rats were fed a standard laboratory diet and water Group II (tramadol-treated group): the rats were given tramadol at a dose of 80 mg/Kgm body weight orally through nasogastric tube for 12 weeks Groups III and IV: they were the withdrawal tramadol groups. Rats that received tramadol were sacrificed after one week of tramadol withdrawal in group 3 and after 2 weeks of tramadol withdrawal in group 4.
Rats were sacrificed by decapitation after light ether anesthesia and dissected at the end of 12th, 13th, and 14th weeks of treatment. All approved conditions used for animal housing and handling were considered. The used experimental protocol followed the regulations for administration and painless sacrifice of the experimental animals.
Parts of each adrenal gland were removed intact and were fixed in 10% buffered formalin followed by paraffin embedding using routine procedures. Seven-micrometer sections were deparaffinized with xylene and stained with haematoxylin and eosin (H&E) to be viewed by light microscopy to examine the adrenal glands [
Other sections were mounted on poly-L-Lysine coated slides and used for immunohistochemical staining with anti-iNOS (inducible nitric oxide synthase) and anti-Caspase-8 according to the previously published protocol [
Tissue sections (adrenal gland) were examined and images were digitally captured using a hardware consisting of high-resolution color digital camera mounted on an Olympus microscope (Olympus BX51, Tokyo, Japan) and connected to a computer and then dealt with using adobe Photoshop.
Tissues were removed and placed in 2.7% glutaraldehyde-0.1 ml phosphate buffer solution for 2 hr and then flooded in 4 consecutive baths of the same fixative 0.15 ml phosphate buffer (4°C) for 1 hr each. The samples were postfixed in a 2% osmic acid-0.15 ml phosphate buffer solution (4°C) for 1 hr, and again 4 times flooded in 0.15 ml phosphate buffer solution for 15 min each. Samples were acetone dehydrated and embedded in polyesteric resin, polymerized at 60°C for 72 hrs (Semithin sections (1
At the end of the experiment, blood samples were withdrawn from the retroorbital plexus of veins using a capillary pipette and collected in heparinized tubes containing 5000 I.U/ml heparin Sodium and centrifuged at 3000 rPm (revolutions per minute) for 15 min. Plasma was separated and stored at −20°C until required. Each sample was used to evaluate the following levels: Cortisol level: cortisol ELISA kits were obtained from antibodies-online GmbH Company, Egypt, according to “Herrero et al. [ DHEAS (dehydroepiandrosterone sulfate) level: the ELISA kits were obtained from GenWay Biotech Company, Egypt, according to “Grimby-Ekman et al. [ Glutathione peroxidase (GSH-Px) level: the kits were obtained from Biodiagnostic Company, Egypt, colorimetric method [ Thioredoxin reductase (TR) level: the kits were obtained from Biodiagnostic Company, Egypt, colorimetric method [
After scarification of rats, parts of adrenal glands were dissected and fixed in 10% formalin and 2.7% glutaraldehyde for histological, immunohistochemical, and ultrastructural studies. The remaining adrenal glands were divided into 2 parts. The 1st part was frozen in liquid nitrogen and stored at −80°C until the analysis of GSH-Px and TR mRNA expression by RT-PCR. The 2nd part was used for biochemical analysis of malondialdehyde (MDA). The kits of MDA were obtained from Biodiagnostic Company, Egypt, and the method of its estimation was done according to “Ohkawa et al. [
Primers, amplicon size, and annealing temperature of glutathione peroxidase (GPX), thioredoxin reductase, B-actin (as internal control for GSH-PX), and 18S (an internal control for TR) were demonstrated in Table
Details giving primer sequences, expected product sizes, and annealing temperature for the genes amplified.
Gene | Primer sequence (5-3) | Product size | Annealing temperature |
---|---|---|---|
GPX | Forward GGAGAATGGCAAGAATGAAGA | 139 pb | 55°C |
Reverse CCGCAGGAAGGTAAAGAG | |||
B-actin | Forward GAGAGGGAAATCGTGCGTGAC | 452 pb | 55°C |
Reverse CATCTGCTGGAAGGTGGACA | |||
Thioredoxin reductase | Forward CCGCAACAGCCAAAATGGTGA | 339 pb | 60°C |
Reverse AGCATGATTAGGCAAACTCCGTAA | |||
18s | Forward TTGACGGAAGGGCACCACCA | 13 pb | 55°C |
Reverse GCACCACCACCCACGGAATCG |
Values were expressed as mean ± standard deviation (SD). The data were analyzed by using SPSS for windows (version 10.0). The significance of differences was calculated by using One-Way ANOVA test.
Figure
Photomicrographs of the adrenal gland of the control group showing (a) adrenal cortex (C), zona glomerulosa (ZG), zona fasciculata (ZF), zona reticularis (ZR), and adrenal medulla (M) ×100. (b) A higher magnification of ZG cells arranged in oval or rounded clusters and with deeply stained nuclei (arrow), ×400. (c) A higher magnification of ZF cells showing highly vacuolated cells (black arrow) and less vacuolated cells with acidophilic cytoplasm (yellow arrow) and vesicular nuclei, ×400. (d) A higher magnification of ZR showing small cells with deeply acidophilic cytoplasm (arrow); M, medulla, ×400.
Examination of sections of the adrenal cortex of group II revealed loss of normal architecture of the ZG and ZF (Figure
Photomicrographs of the adrenal gland of group II showing (A) loss of normal architecture of ZG and ZF, ×100; (B) higher magnification of ZG and ZF showing some cells with marked vacuolated cytoplasm (black arrow) and pyknotic nuclei; others are shrunken (yellow arrow) with pyknotic nuclei and deeply acidophilic cytoplasm; notice the congested blood capillaries (c), ×400; (C) ZR with markedly congested blood capillaries (c), ×100.
Photomicrographs of the adrenal gland of group III showing (A) marked congested blood capillaries of ZF and ZR (arrows), ×100; (B) cells with marked vacuolated cytoplasm and pyknotic nuclei in ZG (black arrows) and ZF (red arrows), ×400; (C) ZR showing cells with vacuolated cytoplasm and pyknotic nuclei (arrows) and markedly congested capillaries (c), ×400.
Photomicrographs of the adrenal gland of group IV showing (a) ZF cells appearing nearly similar to that of control (black arrow); few cells appear shrunken with hyperacidophilic cytoplasm and pyknotic nuclei (yellow arrows), ×400 (b); congested blood capillaries especially at the area of ZR (arrow), ×100; (c) numerous mitotic figures (arrows) in ZR, ×400.
Immunohistochemical staining for iNOS revealed that the sections of the control group showed negative expression along the length of the adrenal cortex including ZG, ZF, and ZR (Figures
Rat adrenal cortex labeled for iNOS of the control group (a and b) showing negative expression; Group II (c and d) showing high expression along the adrenal cortex; Group III showing high expression in ZG and ZR (e) and moderate expression in ZR (f); Group IV (g and h) showing faint expressions through the adrenal cortex, ×400. Zona glomerulosa (ZG), zona fasciculata (ZF), and zona reticularis (ZR).
The caspase-8 immunostaining was negative in the control group along the adrenal cortex (Figures
Rat adrenal cortex labeled for caspase-3 of the control group (a and b) showing negative expression; Group II (c and d) showing high expression along the adrenal cortex; Group III showing high expression in ZG and ZR (e) and moderate expression in ZR (f); Group IV (g and h) showing few scattered immunopositive cells among ZF (arrow), ×400. Zona glomerulosa (ZG), zona fasciculata (ZF), and zona reticularis (ZR).
Results of electron microscopic examinations (EM) revealed that the adrenal cortex of a control rat showed cells of the zona glomerulosa (ZG) with numerous mitochondria, free ribosomes, and few lipid droplets. The lipid droplets were seen as electron lucent with distinct boundaries. The nucleus was spherical or irregular and euchromatic with peripheral heterochromatin (Figure
Electron micrographs of the adrenal cortex of a control group showing ZG cells with (a) spherical or irregular nuclei (N) with peripheral heterochromatin, numerous mitochondria (M), and few lipid droplets (L). (b) Irregular nuclei (N) with peripheral heterochromatin, many mitochondria (M), smooth endoplasmic reticulum (S), some lipid droplets (L), and free ribosomes (arrow).
ZG cells in group II showed numerous degenerated mitochondria with disrupted cristae, dilated cisternae of SER, and few lipid droplets. The nuclei had irregular outlines, shrunken with widened perinuclear space of the nuclear envelope (Figure
Electron micrographs of the adrenal cortex in group II showing that ZG cells with (a) nuclei (N) have irregular outlines and few lipid droplets (L). Notice the shrunken nucleus (n) with widened perinuclear space (arrow in inset). Notice the fibroblast of the capsule with elongated nucleus (fn). (b) Degenerated mitochondria with disrupted cristae (M) and dilated cisternae of SER (s).
The tramadol withdrawal for 1 week showed some enhancement as the adrenal cortex in group III showed ZG cells with euchromatic nuclei of irregular outlines and peripheral clumps of heterochromatin, an apparent increase in lipid droplets, and mitochondria with intact cristae more or less as the control. Some cells showed lipid droplets of indistinct boundaries; widened perinuclear space and large vacuoles were also observed (Figure
Electron micrographs of the adrenal cortex in group III showing that ZG cells with (a) euchromatic nuclei (N) have irregular outlines, an apparent increase in lipid droplets (L), and mitochondria with intact cristae (M). (b) showings cytoplasmic vacuoles (V) and a euchromatic nucleus with peripheral clumps of heterochromatin (N). Note: numerous lipid droplets and mitochondria (M) more or less as the control.
While tramadol withdrawal for 2 weeks showed more enhancement of the adrenal cortex in group IV as ZG cells had euchromatic nuclei with peripheral clumps of heterochromatin, numerous normal mitochondria with intact cristae and decreased lipid droplets compared to group III (Figure
Electron micrographs of the adrenal cortex in group IV showing ZG cells showing euchromatic nuclei with peripheral clumps of heterochromatin (N). Note numerous normal mitochondria (M) and decreased lipid droplets compared to group III.
By EM, zona fasciculata cells of group I showed numerous lipid droplets, many mitochondria with vesicular cristae, smooth endoplasmic reticulum, and euchromatic nucleus with peripheral clumps of heterochromatin (Figure
An electromicrograph of control zona fasciculata cells showing many mitochondria with vesicular cristae (M), smooth endoplasmic reticulum (S), lipid droplets (L), and a euchromatic nucleus with peripheral clumps of heterochromatin (N).
Zona fasciculata cells of group II showed vacuoles of variable sizes with electron-dense cores, mitochondria with destroyed cristae, many lipid droplets without discernible outline, and a shrunken hyperchromatic nucleus with an irregular outline. Some of the lipid droplets fused with each other and became confluent. Other cells had irregular nuclei with dilated perinuclear space and numerous dilated profiles of smooth endoplasmic reticulum (Figure
(a) Electron micrographs of zona fasciculata cells of group II showing vacuoles of variable sizes (V), mitochondria with destroyed cristae (M), lipid droplets without discernible outline (L), and a shrunken hyperchromatic nucleus with an irregular outline (N). Note confluent lipid droplets (star). (b) Another cell has an irregular nucleus (N) with dilated perinuclear space (arrow), mitochondria with destroyed cristae (M), and numerous dilated profiles of smooth endoplasmic reticulum (s). Notice cytoplasmic vacuoles with electron-dense cores (circles).
Fasciculata cells from group III contained numerous intact mitochondria and lipid droplets. But some of the lipid droplets were still confluent and showed no discernible outline. Some cells had rounded euchromatic nuclei and others had irregular nuclei and dilated nuclear envelope (Figure
An electron micrograph showing fasciculata cells from group III containing numerous mitochondria (M) and lipid droplets (L). Note large vacuoles (V). Cells have rounded euchromatic nucleus (N) and the other has irregular dense nucleus (n).
Fasciculata cells from group IV showed most cells with euchromatic nuclei with regular outline, numerous mitochondria with intact cristae, and numerous lipid droplets. Few cells had confluent lipid droplets and scarce nuclei were shrunken and hyperchromatic (Figure
An electron micrograph showing fasciculata cells from group IV showing cells with euchromatic nuclei (N) with regular outline (arrow), numerous mitochondria with intact cristae (M), and numerous lipid droplets (L). Note some confluent lipid droplets (stars) and the irregular shrunken hyperchromatic nucleus (n).
Cortisol and DHEAS levels showed a significant decrease in groups II, III, and IV when compared with group I. Also, there is a significant increase in both hormonal levels in groups III and IV compared to group II. Two-week withdrawal of tramadol in group IV resulted in significant increase in the levels of the previous hormones than group III (one-week withdrawal of tramadol) but still did not reach its level in control group (Table
One-way ANOVA statistical analysis of cortisol and DHEAS levels in different experimental groups
|
|
||||
---|---|---|---|---|---|
Group | |||||
Group I | Group II | Group III | Group IV | ||
Mean ± SD |
|
|
|
|
<0.00 |
Post hoc LSD analysis | |||||
Group I | 0.00 |
0.00 |
<0.00 |
||
Group II | <0.00 |
<0.00 |
|||
Group III | <0.00 |
||||
|
|||||
|
|
||||
Group | |||||
Group I | Group II | Group III | Group IV | ||
|
|||||
Mean ± SD |
|
|
|
|
<0.00 |
Post hoc LSD analysis | |||||
Group I | 0.00 |
<0.00 |
<0.00 |
||
Group II | <0.00 |
<0.00 |
|||
Group III | 0.00 |
Tables
One-way ANOVA statistical analysis of GSH-Px level in different experimental groups
|
|
||||
---|---|---|---|---|---|
Group | |||||
Group I | Group II | Group III | Group IV | ||
Mean ± SD |
|
|
|
|
<0.00 |
Post hoc LSD analysis | |||||
Group I | 0.00 |
0.00 |
<0.00 |
||
Group II | <0.00 |
<0.00 |
|||
Group III | <0.00 |
GSH-Px: glutathione peroxidase;
One-way ANOVA statistical analysis of plasma TR level in different experimental groups
|
|
||||
---|---|---|---|---|---|
Group | |||||
Group I | Group II | Group III | Group IV | ||
Mean ± SD |
|
|
|
|
<0.00 |
Post hoc LSD analysis | |||||
Group I | 0.00 |
<0.00 |
<0.00 |
||
Group II | <0.00 |
<0.00 |
|||
Group III | 0.00 |
TR: thioredoxin reductase;
Adrenal gland MDA revealed significant increase in groups II, III, and IV compared to group I. MDA level was significantly decreased in groups III and IV than group II. Significant decrease in MDA level was noticed in group IV when compared to group III but still did not reach the level of the control group (Table
One-way ANOVA statistical analysis of MDA level in adrenal glands in different experimental groups
|
|
||||
---|---|---|---|---|---|
Group | |||||
Group I | Group II | Group III | Group IV | ||
Mean ± SD |
|
|
|
|
<0.00 |
Post hoc LSD analysis | |||||
Group I | 0.00 |
<0.00 |
0.00 |
||
Group II | <0.00 |
<0.00 |
|||
Group III | <0.00 |
Tables
One-way ANOVA statistical analysis of the intensity of the PCR product bands of GSH-Px among different experimental groups
|
|
||||
---|---|---|---|---|---|
Group | |||||
Group I | Group II | Group III | Group IV | ||
Mean ± SD |
|
|
|
|
<0.00 |
Post hoc LSD analysis | |||||
Group I | 0.00 |
0.00 |
<0.00 |
||
Group II | <0.00 |
<0.00 |
|||
Group III | <0.00 |
GSH-Px: glutathione peroxidase;
One-way ANOVA statistical analysis of the intensity of the PCR product bands of TR among different experimental groups
|
|
||||
---|---|---|---|---|---|
Group | |||||
Group I | Group II | Group III | Group IV | ||
Mean ± SD |
|
|
|
|
<0.00 |
Post hoc LSD analysis | |||||
Group I | 0.00 |
0.00 |
0.00 |
||
Group II | <0.00 |
<0.00 |
|||
Group III | 0.00 |
TR: thioredoxin reductase;
Agarose gel electrophoresis of RT-PCR products showed increase in the expression of GSH-Px genes in adrenal glands in tramadol withdrawal groups (groups III and IV) more than tramadol group (group II).
Agarose gel electrophoresis of RT-PCR products showed increase in the expression of TR genes in adrenal glands in tramadol withdrawal groups (groups III and IV) more than tramadol group (group II).
Tramadol is a synthetic-4-phenyl-piperidine analogue of codeine. It is a central analgesic with a low affinity for opioid receptors. It is used to treat moderate to severe pain through combination of mu-opioid agonist effects and norepinephrine and serotonin reuptake inhibition. The M1 metabolite of tramadol produced by liver-O-demethylation shows a higher affinity for opioid receptors than the parent drug [
Tramadol abuse has dramatically increased in Middle East region especially in Iran and Egypt. The prevalence was higher in males (77.2%). Among Secondary School male students, 0.84% abused opiates. The last national survey report stated that 9.6% of Egyptians used drugs at least once during their lives [
Connor et al. [
Tramadol in this present study was given at a dose of 80 mg/Kg body weight orally (35% of oral LD50 of tramadol in rats) according to the study of “El-Gaafarawi [
Opioid-induced endocrinopathy is one of the most common, yet, least often diagnosed consequences of prolonged opioid therapy. Many studies have evaluated the effects of chronic use of tramadol on many organs, for example, liver, kidney, testes, ovaries, heart, and thyroid gland. Owing to the presence of limited numbers of literatures that study the pathological effects of tramadol on adrenal glands, the authors ran out this work to illustrate the dramatic histopathological effects of tramadol on adrenal glands.
The present study proved that chronic use of tramadol induced pathological changes in adrenal glands in the form of loss of normal architecture of ZF and ZG. The cells became ballooned and vacuolated with pyknotic nuclei and congested blood capillaries by light microscopic examination. Immunohistochemical staining for iNOS and Caspase-8 revealed high positive expression in the cytoplasm of cells of all zones of adrenal cortex of rats in tramadol-treated group.
Ultrastructural examinations of adrenal glands in this present study showed numerous degenerated mitochondria with disrupted cristae and irregular outlines of nuclei of ZG cells. ZF cells showed multiple vacuoles, shrunken hyperchromatic nuclei with an irregular outline, and dilated profiles of smooth endoplasmic reticulum.
The pathological changes and oxidative damage induced by chronic use of tramadol can be explained by its capability to generate oxygen free radicals that can attack the cell membrane and lead to destabilization and disintegration of cell membrane as a result of lipid peroxidation [
After one-week withdrawal of chronic tramadol use, the same morphological changes were observed in group III as that in group II by light microscopic examination. By immunohistochemical study, the expression of iNOS and Caspase-8 was high in ZG and ZF, while, in ZR, moderate expression was noticed. Ultrastructural examination of adrenal glands revealed some enhancement of ZG and ZF cells and appearance of euchromatic nuclei of irregular outline and peripheral clumps of heterochromatin.
Two-week withdrawal of tramadol led to more improvement of the morphological changes in ZG, ZF, and ZR cells more or less similar to that of control group by light and electron microscopic examination. Faint expression of iNOs and Caspase-8 in the cytoplasm of ZG, ZF, and ZR cells was noticed by immunohistochemical studies.
To our knowledge, after surfing all available search engines, there is no single study that could determine the biochemical oxidative stress induced by chronic tramadol use and its withdrawal effects on adrenal gland and the effect of tramadol on the genetic expression of some antioxidant enzymes; therefore, the aim of this study was to determine the biochemical changes (hormonal, oxidative stress, and genetic expression) that can be induced by chronic use of tramadol and its withdrawal.
Chronic tramadol use in the research led to significant increase in the level of adrenal MDA, in addition to a significant decrease in the level of antioxidant enzymes (GSH-Px and TR) in the blood. Tramadol withdrawal resulted in significant decrease in the level of MDA and significant increase in the level of the above enzymes after 2-week withdrawal was more than one-week tramadol withdrawal. These results were confirmed by studying the genetic expression of GSH-Px and TR in suprarenal gland. Agarose gel electrophoresis of RT-PCR products showed increase in the expression of GSH-Px and TR genes in adrenal glands in tramadol withdrawal groups (groups III and IV) more than tramadol group (group II).
Ghoneim et al. [
The hormonal changes induced by chronic tramadol use in this study revealed a significant decrease in the levels of cortisol and DHEAS in tramadol group and a significant increase in their level after tramadol withdrawal (more after 2-week tramadol withdrawal). These results cope with the results as discussed by other studies [
Knowledge of opioid-induced adrenal insufficiency is limited by the lack of large scale studies. Opioids may decrease adrenal stress response, leading to symptoms of adrenal insufficiency during acute illness or stress. The main important mechanism in opioid-induced endocrinopathy is the large dramatic effect of opioids on the hypothalamic-pituitary-adrenal axis (HPA). Suppression of HPA was shown in patients on long term use of morphine, chronic transdermal fentanyl, methadone, and tramadol [
Moreover, patients with mu receptors polymorphism A118G would have more opioid endocrinopathy and more opioid suppression of neurons that release corticotropin releasing hormone (CRH) which would explain how opioids induced adrenal insufficiency in such individuals [
Finally, it is concluded that chronic use of tramadol can cause many hazardous effects on different body organs. And, from this current study, it is approved that chronic use of tramadol caused adrenal insufficiency both histologically and biochemically and stoppage of tramadol use leads to a decrease in its hazardous effects not only on adrenal glands but also on different body organs.
So, it is recommended to address public associations and government agencies for raising awareness against hazards of tramadol. Holding seminars for students of preparatory and high schools should be done to obtain knowledge about bad effects of tramadol to reduce its addiction among them. Additionally, it is advised to add drug screening for tramadol to all forms of basic toxicological screening and to set strict sanctions on drivers and workers with a positive test and on pharmacies that sell tramadol without medical prescription. Finally, the results of our study emphasize the need for future researches that can explain the other possible mechanisms of adrenal insufficiency induced by chronic use of tramadol.
There are no conflicts of interest between any of the authors regarding the publication of this paper.