Patients with breast cancer often exhibit significant emotional instability, especially depression, and the probability of being accompanied by depression has been reached at 40% [
Traditional Chinese medicine is based on dialectical treatment, which has a significant therapeutic effect on the progression of breast cancer and drug resistance [
Previous studies suggested that the pathogenesis of BCRD mainly focused on autonomic neuroimmunity, neuroendocrine immunity, and oxidative stress injury, which are related to inflammation [
Based on the above background, our study was aimed at investigating the function of the Xiaoyao Kangai Jieyu Formula in inflammatory responses during the progression of BCRD. We hope that this work will exert novel insights into discovering the new methods against BCRD.
The active constituents of the Xiaoyao Kangai Jieyu Formula were obtained in 3 steps as previously described [
The target protein was predicted using the TCMSP database and DrugBank (
The intersection between the targets of the Xiaoyao Kangai Jieyu Formula and proteins (related to BCRD) was taken as the PATPs for the following analysis.
In order to clarify the associations between PATPs, the STRING database was applied to establish the network of PPI. Moreover, the species were only adaptive to Homo sapiens, and a confidence score of 0.95 (<0.4 was considered low confidence, ≤0.7 regarded as medium, and >0.7 considered high) was selected in this analysis. Further experiments used the PPI data. Then, CytoNCA (a Cytoscape plugin) was applied to assess the network of PPI, and the network was established by top proteins (
The molecular mechanisms of the Xiaoyao Kangai Jieyu Formula were determined using GO analysis. MCODE (a Cytoscape plugin) was applied in GO biological process analysis. In detail, the data of PPI were filtered in Cytoscape applying MCODE in this procedure. 0.05 was considered the significance level.
KEGG analysis was applied to explore potential pathways and biological functions in this work. In addition, KEGG analysis was applied with the ClusterProfiler package of the R language. 0.05 was considered the significance level.
Samples were placed on dry ice and weighed. A freeze tissue grinder was applied to homogenize the tissue. Tissue homogenate (200
Breast cancer cells (4T1) were purchased from the Chinese Academy of Sciences. Nashed et al. showed that 4T1 facilitates the induction of depression-like states in mice [
The Xiaoyao Kangai Jieyu Formula was obtained from Changdu Zhenxing Lo. Ctd. (Hunan, China). The Xiaoyao Kangai Jieyu Formula consists of Bupleurum, Angelica, white peony, poria, Atractylodes, Prunella vulgaris, ginseng, turmeric, Hypericum perforatum, and roasted licorice.
4T1 cells were exposed to LPS (Sigma, 10
Nude mice (BALB/c,
Mice in the BCRD+Pac group were injected intraperitoneally with paclitaxel liposomes (20 mg/kg) weekly. Mice in the BCRD+Flu group were administered with fluoxetine hydrochloride (7.8 mg/kg) every day. Mice in the quercetin group were injected intraperitoneally with quercetin at an equivalent daily dose. In addition, mice in the control, depression, BCRD, and breast cancer group were administered with the same amount of distilled water. After 3 weeks of treatment, each group of mice was analyzed according to multiple indicators [
The Institutional Animal Care and Use Committees of the Affiliated Cancer Hospital of Xiangya School of Medicine, Central South University, approved the protocol of this work (number 2021-056). The treatment of animals during the experiment conforms to the standards of “Guiding Opinions on Being Kind to Experimental Animals” issued by the Ministry of Science and Technology in 2006.
Decreasing sucrose preference is considered homologous anhedonia, inability to experience pleasure, which mimics depression. The water bottles (
The forced swimming test (FST) is used to measure changes in depressive behavior. The mice received FST, which was in line with the recent work [
The mice were individually suspended with tap and separated from each other. Then, the tape was placed 1 cm from the tail tip. The status of the mice was observed for 6 minutes, and the result was recorded.
Cells (
In brief, EthD-III (2
TRIzol (Takara, Tokyo, Japan) was applied to isolate tissues or cells from total RNAs. The PrimeScript RT reagent Kit (Takara) was applied to synthesize cDNAs. The ABI7500 system was performed in RT-qPCR performing SYBR Green. RT-qPCR was applied as follows: 94°C for 2 min, followed by 35 cycles (94°C for 30 s and 55°C for 45 s). The primers originated from GenePharma (Shanghai, China). The
Gene | Primer sequence | Gene ID | Length |
---|---|---|---|
NLRP3 | FCCTCTTTGGCCTTGTAAACCAG | 216799 | 113 bp |
ASC(PYCARD) | FCAGAGTACAGCCAGAACAGGACACT | 66824 | 91 bp |
Caspase-1 | FACAAGGCACGGGACCTATG | 12362 | 237 bp |
FACATCCGTAAAGACCTCTATGCC | 1146 | 223 bp |
RIPA buffer was applied to isolate protein from tissues or cell lysates. BCA (Invitrogen) was applied in protein quantification. Subsequently, SDS-PAGE (10%) was applied to separate the proteins (40
The ELISA kit originated from Jiancheng, Nanjing (China). The levels of 5-HT (item number: H104-1-1), DA (item number: H170), NE (item number: H344-1), IL-2 (item number: H003), IFN-
The tumors were dissociated and suspended. CD8-APC and CD4-FITC were subsequently applied to stain the cells for 15 minutes at 4°C. Afterward, cells were permeabilized for Foxp3-PE (eBiosciences) staining. Flow cytometry (BD FACSAria, USA) was applied to analyze the cells after cells. FlowJo (BD) was applied to quantify the data.
KCl (10%) was applied to arrest the tissues, and a Canon camera (Tokyo) was applied to capture the images of tissues. Hematoxylin and eosin (H&E) were applied to stain the sections (4
Data analysis was applied by using SPSS v18.0 (USA).
A total of 156 targets were obtained through a comprehensive analysis of the active ingredients of the Xiaoyao Kangai Jieyu Formula, breast cancer, and depression (Figure
Active targets and PPI network. (a) The overlapped potential active target proteins were presented. (b) The network of PPI containing the active targets was presented. The redder the color, the greater the degree value. The line from thick to thin indicates that the edge betweenness is from big to small. (c) Prediction of the top 20 key targets. The horizontal coordinate is the degree value of each target.
Core genes were screened by MCODE analysis. Four gene clusters and four core genes were obtained: APP, AKT1, IL10 and POR, respectively (Table
Cluster analysis based on Molecular Complex Detection.
Cluster | Network | Nodes | Edges | Node IDs |
---|---|---|---|---|
1 | 28 | 254 | FOS, STAT1, CXCL8, STAT3, ICAM1, IL1A, IL1B, MYC, AR, CCL2, HMOX1, ERBB2, IFNG, MAPK3, EGF, MMP9, PTEN, JUN, MAPK14, CCND1, IL2, MAPK1, EGFR, IL10, ESR1, IL6, CASP3, PTGS2 | |
2 | 16 | 39 | SELE, MET, PPARG, BCL2L1, CXCL10, IL4, NOS3, VEGFA, CRP, TGFB1, HIF1A, MAPK8, MMP2, MMP1, MMP3, AKT1 | |
3 | 7 | 14 | GSTP1, CYP3A4, CYP1B1, CYP1A2, NQO1, POR, GSTM1 | |
4 | 22 | 47 | RUNX2, APP, CXCL11, OPRD1, BAX, ADRA2A, HTR2A, GRM1, CHRM1, RB1, CASP8, GNRH1, CDKN1A, MAPK10, GNRHR, BCL2, ADRA1A, CASP9, SPP1, MDM2, CCNB1, OPRM1 |
Based on the included active ingredients, BCRD, and targets, the active ingredient-disease-target network was constructed (Supplementary Figure
Next, GO analysis showed that the active components of the compound were mainly involved in response to lipopolysaccharide, response to drug, and response to molecule of bacterial origin (Figure
The GO data of enrichment and KEGG analysis. (a) GO analysis was performed to investigate the cellular biological process. (b) KEGG analysis was performed to investigate the most enriched pathways. (c) The network of constituents-diseases-pathways-targets.
To mimic BCRD
The occurrence of BCRD induced the pyroptosis of neurons. Neurons were treated with LPS+4T1, LPS+4T1+BCRD, or LPS+4T1+CORD. (a, b) EthD-III staining was used to observe the membrane pores of neurons. (c–e) Caspase-1, ASC, and NLRP3 levels in neurons were assessed by RT-qPCR. (f) ASC, caspase-1, and NLRP3 levels in neurons were investigated by western blot.
Since quercetin was identified as the key constituent of the Xiaoyao Kangai Jieyu Formula, the following analysis was applied to analyze the impact of quercetin on BCRD progression. The data confirmed that the viability of neurons was significantly decreased by the supernatants of LPS-treated 4T1 cells, which was significantly reversed by Pac+Flu or quercetin (Figure
Quercetin significantly reversed BCRD-induced cell pyroptosis. Neurons were divided into BCRD, BCRD+quercetin, or BCRD+Pac+Flu. (a) The viability of neurons was assessed by the CCK8 assay. (b–d) The levels of NLRP3, ASC, and caspase-1 in neurons were investigated by RT-qPCR. (e) ASC, NLRP3, and caspase-1 levels in neurons were investigated by western blot.
To assess the function of quercetin in BCRD
Quercetin alleviated neuron injury and depressive behavior in BCRD mice. (a) The sugar preference rate of mice was detected. (b) The immobility time was recorded after the forced swimming test. (c) The immobility time was recorded after the tail suspension test. (d–f) ASC, NLRP3, and caspase-1 levels in neurons were assessed by RT-qPCR. (g–j) NLRP3, ASC, and caspase-1 levels in neurons were investigated by western blot.
A xenograft mouse model was constructed to assess the effect of quercetin on immune response in BCRD mice. The result indicated that BCRD further increased the tumor sizes and weight in breast cancer mice, while this phenomenon was notably revised by quercetin or Pac+Flu (Figures
Quercetin promoted an anti-tumor immune response in BCRD mice. (a) The tumor tissues of mice were collected. (b) The tumor volume was calculated. (c) The tumor weight was recorded. (d) The histological change in mice was detected by H&E staining. (e) The expression of CA153 was assessed. (f, g) The ratio of CD4+ and CD8+ in mice was assessed by flow cytometry. (h–j) IL-2, IFN-
As revealed in Figures
Quercetin might promote the antitumor immune response in BCRD mice via regulation of serum metabolism. (a) Principal component analysis. (b) Partial least squares discriminant analysis (PLS-DA). (c) Sparse partial least squares discriminant analysis (SPLS-DA). (d) Differential metabolites are represented by a volcano plot. (e) KEGG pathway enrichment analysis of differential metabolites.
BCRD seriously impairs the quality of life of patients. It was reported that traditional Chinese medicine could inhibit cancer and depression development [
This study assessed the mechanisms of the Xiaoyao Kangai Jieyu Formula on BCRD, and downstream proteins and the active constituents were predicted. The Xiaoyao Kangai Jieyu Formula active constituent-target network revealed the pharmacological foundation of the Xiaoyao Kangai Jieyu Formula. The targets and active constituents were hypothesized in this section. Flavonoids are the main active constituents of the Xiaoyao Kangai Jieyu Formula. Moreover, quercetin is known to be a polyphenolic flavonoid that has antitumor activity, and it exerts in the source of vegetal food and multiple traditional Chinese medicines [
Meanwhile, quercetin has multiple biological activities. For example, quercetin attenuates LPS-induced depression-like behavior and learning memory impairment in rats, which may be related to its modulation in the imbalance of hippocampal Copine 6 and TREM1/2 expression associated with brain-derived neurotrophic factor [
Recent studies indicated that pyroptosis plays a crucial role in the cellular process [
It has been reported that disruption to metabolism could lead to the progression of depression [
There are some limitations in this work as follows: (1) the mechanisms by which quercetin regulates the progression of BCRD remain unclear and (2) the relation between quercetin and serum metabolism-related signaling is needed to be analyzed. Hence, more analysis is essential in the future.
To sum up, quercetin, the active ingredient of the Xiaoyao Kangai Jieyu Formula, effectively mitigated the progression of BCRD by inhibiting pyroptosis, promoting immune response, and improving serum metabolism.
The data used to support the findings of this study are available from the corresponding author upon request.
There was no competing interest to declare.
Qing Zhu contributed to conceptualization, investigation, methodology, and visualization and wrote the original draft. Lei Yang and Hui Yang contributed to formal analysis, investigation, and validation and wrote the original draft. Yuanshan Han contributed to conceptualization, performed the research, and analyzed the data. Yun Chen and Ying He were responsible for data curation, funding acquisition, project administration, and supervision and reviewed and edited the paper. All authors contributed to the article and approved the submitted version.
This study was funded by the National Natural Science Foundation of China (82104846), supported by the Hunan Provincial Natural Science Foundation of China (2019JJ80021), supported by the Scientific Research Project of Hunan Provincial Health Commission (202103101959), and supported by the Science and Technology Innovation Program of Hunan Province (Grant No. 2019SK20321).
Supplementary Table 2: the information of key ingredients.
Supplementary Figure 1: the network of active ingredient-disease-target.
Supplementary Figure 2: CD4+ and CD8+ ratios in mice.
Supplementary Figure 3: the heat map of differential metabolites in plasma of mice.
Supplementary Figure 4: primary mouse neuronal cell identification. (A) Representative image of primary mouse cortical neurons. (B) IF for identification of primary neurons.