Emerging evidences highlight the implication of microRNAs as a posttranscriptional regulator in aging. Several senescence-associated microRNAs (SA-miRNAs) are found to be differentially expressed during cellular senescence. However, the role of dietary compounds on SA-miRNAs remains elusive. This study aimed to elucidate the modulatory role of tocotrienol-rich fraction (TRF) on SA-miRNAs (miR-20a, miR-24, miR-34a, miR-106a, and miR-449a) and established target genes of miR-34a (CCND1, CDK4, and SIRT1) during replicative senescence of human diploid fibroblasts (HDFs). Primary cultures of HDFs at young and senescent were incubated with TRF at 0.5 mg/mL. Taqman microRNA assay showed significant upregulation of miR-24 and miR-34a and downregulation of miR-20a and miR-449a in senescent HDFs (
Tocotrienols, the lesser known isomer of vitamin E, have gained increasing scientific interest in the study of aging and aging-related diseases due to its eminent antioxidant effects and nonantioxidant activity [
Accumulating evidences demonstrated that tocotrienol modulates several mechanisms associated with aging. In individuals over 50 years old, tocotrienol-rich fraction supplementation decreased DNA damage [
Human diploid fibroblasts (HDFs) undergo irreversible proliferative arrest, termed as replicative senescence, after around 50 cell divisions when cultured
Proliferating cells succumbed to cell cycle arrest when cellular macromolecules (DNA, protein, and lipid) are damaged by reactive oxygen species (ROS) constantly generated during physiological metabolism [
The role of miRNAs in regulating aging process has been established recently, with the discovery of miRNA, lin-4 that regulates the lifespan in
Several miRNAs (including miR-20a, miR-24, miR-34a, miR-106a, and miR-449a) that funnel proliferating cells to senescence regulate cellular senescence via either or both p53/p21 and p16/pRb pathways [
Despite the reported discrepancies between the upregulation and downregulation of miRNAs during aging and cellular senescence, such as miR-34a [
The present study aimed to elucidate the molecular mechanism of TRF in reversing cellular aging through cell cycle arrest prevention focussing on the modulation of SA-miRNAs expression and, hence, alteration of their target genes expression which are involved in cell cycle regulation.
This research was conducted with the approval of Ethics Committee of Universiti Kebangsaan Malaysia (Approval Project Code: FF-215-2013). Primary HDFs were derived from circumcised foreskins of 9 to12 year-old boys. Written consents were obtained from parents of all subjects.
Aseptically collected skin samples were rinsed several times with 75% alcohol and phosphate buffered saline (PBS) containing 1% antibiotic-antimycotic solution (PAA, Austria). After removing the epidermis, the dermis was cut into small pieces and transferred into 0.03% collagenase type I digestive buffer (Worthington Biochemical Corporation, USA). Pure dermis was digested in incubator shaker at 37°C for 6–12 h. The isolated cells were rinsed with PBS before being cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% foetal bovine serum (FBS) (PAA, Austria) and 1% antibiotic-antimycotic solution at 37°C in 5% CO2 humidified incubator. After 5-6 days, the cultured HDFs were trypsinized and culture-expanded into new T25 culture flasks. When the subcultures were 80–90% confluent, serial passaging was done by trypsinization while the number of population doublings (PDs) was monitored until HDFs reached senescence. For subsequent experiments, HDFs used were at passage 6 (young HDFs, PD < 12) and passage 30 (senescent HDFs, PD > 55).
Stock solution of TRF was freshly prepared in dark by dissolving 1 g Gold Tri E 50 (Sime Darby Bioganic Sdn. Bhd., Malaysia) in 1 mL 100% ethanol (1 : 1) and kept at −20°C for not more than one month. TRF was activated by incubating 45
SA-
Forward primers for miRNAs were designed according to the miRNAs sequences listed in miRBase database (
Forward primer sequences for validated miRNAs.
Accession number | miRBase ID | Mature miRNA sequences (5′ |
Size (bp) |
---|---|---|---|
miRBase | |||
MIMAT0000075 | hsa-miR-20a-5p | UAAAGUGCUUAUAGUGCAGGUAG | 23 |
MIMAT0000080 | hsa-miR-24-3p | UGGCUCAGUUCAGCAGGAACAG | 22 |
MIMAT0000255 | hsa-miR-34a-5p | UGGCAGUGUCUUAGCUGGUUGU | 22 |
MIMAT0004517 | hsa-miR-106a-3p | CUGCAAUGUAAGCACUUCUUAC | 22 |
MIMAT0001541 | hsa-miR-449a | UGGCAGUGUAUUGUUAGCUGGU | 22 |
NCBI | |||
NR_002752 | RNU6B | CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU | 42 |
Primers sequences for quantitative gene expression analysis.
Accession number | Gene | Primer | Primer sequences |
PCR product size (bp) |
---|---|---|---|---|
NM_002046 | GAPDH | Forward | TCCCTGAGCTGAACGGGAAG | 217 |
GAPDH | Reverse | GGAGGAGTGGGTGTCGCTGT | ||
|
||||
NM_053056 | CCND1 | Forward | AGACCTTCGTTGCCCTCTGT | 181 |
CCND1 | Reverse | CAGTCCGGGTCACACTTGAT | ||
|
||||
NM_000075 | CDK4 | Forward | TGGCCCTCAAGAGTGTGAGA | 147 |
CDK4 | Reverse | ATGTGGCACAGACGTCCATC | ||
|
||||
NM_012238 | SIRT1 | Forward | GCAGATTAGTAGGCGGCTTG | 152 |
SIRT1 | Reverse | TCTGGCATGTCCCACTATCA | ||
|
||||
NM_000546 | TP53 | Forward | GGAAGAGAATCTCCGCAAGAA | 177 |
TP53 | Reverse | AGCTCTCGGAACATCTCGAAG |
Total RNA was extracted from different groups of HDFs using TRI Reagent (Molecular Research Center, Cincinnati, USA) according to the manufacturer’s instructions. Polyacryl Carrier (Molecular Research Center, Cincinnati, USA) was added to each extraction to precipitate the total RNA. Extracted RNA pellet was washed with 75% ethanol and dried prior to dissolving it in RNase-free and DNase-free distilled water. Aliquots of total RNA were stored at −80°C immediately after extraction. The yield and purity of extracted total RNA were determined by Nanodrop (Thermo Scientific, USA).
Young HDFs were reverse transfected with mirVana miR-34a Mimic 1 (Ambion, USA) at a final concentration of 10 nM to overexpress miR-34a in the cells, using Lipofectamine RNAiMAX (Invitrogen, USA).
For quantitative analysis of miRNAs, reverse transcription (RT) was first performed using Taqman MicroRNA Reverse Transcription kit (Applied Biosystems, USA) according to manufacturer’s instructions with total RNA at 10 ng. PCR reactions were then performed according to manufacturer’s instructions to quantitate the expression levels of miRNAs (miR-20a, miR-24, miR-34a, miR-106a, and miR-449a) using Taqman Universal PCR Master Mix, No AmpErase UNG (Applied Biosystems, USA), and Taqman microRNA assay (Applied Biosystems, USA) for the miRNAs of interest. The PCR amplification was performed in iQ5 Multicolor Real Time PCR (Bio Rad, USA) at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 60 s. The PCR incubation profile was extended to 45 cycles for miR-20a and miR-449a. PCR reactions were performed in triplicate. All miRNAs expressions were normalized to the expression of RNU6B. The relative expression value (REV) of miRNAs was calculated using the
Data were presented as mean ± SD. ANOVA was used for multiple comparisons of groups. Mann-Whitney
Changes in cell morphology and increase in SA-
Morphological changes and SA-
Changes in miRNAs expressions were observed in HDFs with senescence. The expression of miR-20a and miR-449a was decreased while the expression of miR-24 and miR-34a was increased significantly in senescent HDFs as compared to young HDFs (
Effect of TRF treatment on the expression levels of miR-20a (a), miR-24 (b), miR-34a (c), and miR-449a (d) in young and senescent HDFs measured by real time qRT-PCR.
The expression level of miR-34a increased significantly (
Effect of TRF treatment on the expression level of miR-34a in nontransfected young HDFs, young HDFs transfected with miR-34a mimic, miRNA negative control, and senescent HDFs measured by real time qRT-PCR. Young HDFs were transfected with miR-34a mimic (10 nM) to overexpress miR-34a or miRNA negative control as control for 24 h, followed by TRF treatment for 24 h.
Ectopic expression of miR-34a reduced the gene expression of CDK4 significantly (
Effect of TRF treatment on the expression level of CDK4 (a), CCND1 (b), SIRT1 (c), and TP53 (d) in nontransfected young HDFs, young HDFs transfected with miR-34a mimic, miRNA negative control, and senescent HDFs measured by real time qRT-PCR.
In this study, cellular morphological changes and increased SA-
It has been reported that changes in miRNA expression occurred with human aging [
Decrease in miR-20a expression in senescent cells observed in this study, which was also reported in previous studies [
Deep sequencing analysis [
Increased miR-34a expression in senescent HDFs observed in this study which is in agreement with earlier reported literature [
To characterize miR-34a targets, we have identified CDK4, CCND1, and SIRT1 as the target genes of miR-34a, using database of experimentally verified targets of miRNAs (TarBase 6.0) [
Our findings showed that ectopic delivery of miR-34a in young HDFs significantly increased miR-34a expression level which increased the inhibitory effect of miR-34a on target genes. Transfection of miR-34a mimic into young HDFs resulted in sufficient increase in miR-34a levels to cause a corresponding decrease in the expression of the predicted target, CDK4, whereas the gene expression of CCND1, SIRT1, and TP53 was not affected.
Elevated level of miR-34a in senescent HDFs was not sufficient to repress CDK4 gene expression. However, ectopic expression of miR-34a showed significant inhibition effect on CDK4 gene expression, suggesting that miR-34a level is important in determining its effect on CDK4 gene expression. TRF treatment increased CDK4 gene expression in young nontransfected and transfected HDFs but not senescent HDFs. This interestingly suggested that TRF treatment suppressed miR-34a expression and thus relieved its inhibition on CDK4 gene expression. Increased CDK4 level encourages more cyclin D1/CDK4/CDK6 complexes to be formed, which favours cell cycle progression and cell proliferation. In addition, high level of CDK4 ensures its function will not be diminished completely by
Decreased CCND1 gene expression was reported with ectopic expression of miR-34a with a higher concentration of miR-34a duplex (50 nM) [
Increased expression of miR-34a did not result in SIRT1 mRNA degradation even though translational inhibition of SIRT1 by miR-34a upregulation has been reported [
Although previous study demonstrated that miR-34a is the direct transcriptional target of p53 [
p53-miR-34a-SIRT1 positive feedback loop suggested that p53 induces miR-34a expression which suppresses SIRT1, increasing p53 activity [
This study also observed the downregulation of miR-449a in senescent HDFs. Similarly, genome-wide analysis of miRNA expression revealed miR-449a was downregulated with age [
TRF treatment was found to have increased miR-449a expression in both young and senescent HDFs, indicating that TRF modulated miR-449a expression but not specifically for senescent cells. Increased miR-449a expression in young and senescent cells may be accompanied with the elevated level of miR-449a transcription regulator, E2F1, to promote cell cycle progression [
In this study, the proposed mechanism which underlies TRF mediated regulation of miRNAs may be attributed to its radical-scavenging effect [
Figure
Modulatory effect of tocotrienol-rich fraction on the expression of SA-miRNAs at transcriptional level.
Modulatory effect of tocotrienol-rich fraction on the expression of miR-34a associated genes at transcriptional level when miR-34a is overexpressed.
In the present study, we demonstrated that tocotrienol-rich fraction with antioxidant and nonantioxidant properties altered the expression of SA-miRNAs specifically miR-34a and, therefore, alters the expression of miR-34a target genes involved in cell cycle regulation to promote cell cycle progression in senescent HDFs.
Advanced glycosylation end product
Adenosine monophosphate-activated protein kinase
Cyclin D1
Cyclin E2
Cyclin-dependent kinase inhibitor
Cyclin-dependent kinase
Dulbecco’s modified Eagle medium
ETS-like gene 1
E2 promoter binding factor
Foetal bovine serum
Glyceraldehydes 3-phosphate dehydrogenase
Human diploid fibroblast
Inculin-like growth factor 1
MicroRNA
Phosphate buffered saline
Population doubling
Retinoblastoma protein
Quantitative reverse transcription-polymerase chain reaction
Reactive oxygen species
Senescence-associated microRNAs
Senescence-associated beta-galactosidase
Sirtuin 1
Target of rapamycin
Tumour protein 53
Tocotrienol-rich fraction
Untranslated region.
The authors declare that they have no conflict of interests.
This study was financially supported by Universiti Kebangsaan Malaysia Grants UKM-DLP-2011-042 and UKM-FF-215-2013.