Low back pain (LBP) is the primary cause of disability globally. There is a close relationship between Modic changes or endplate defects and LBP. Endplates undergo ossification and become highly porous during intervertebral disc (IVD) degeneration. In our study, we used a mouse model of vertebral endplate degeneration by lumbar spine instability (LSI) surgery. Safranin O and fast green staining and
Low back pain (LBP) is the primary cause for disability globally [
To search the main cause of LBP, many research groups have been concentrating on the aneural [
Endplates undergo ossification and become highly porous during IVD degeneration [
Prostaglandin E2 (PGE2) is a lipid factor generated at the damaged region in diverse tissues, which could lead to inflammatory or neuropathic pain [
The PGE2/EP4 pathway could activate a series of pain-related ion channels, such as transient receptor potential vanilloid 1 (TRPV1) [
In this study, we found an elevated concentration of PGE2 in the porous endplate of LSI mice. This high-level PGE2 activated the TRPV1 channel in DRG neurons via its EP4 receptor in the CGRP+ sensory nerve, which causes spinal hypersensitivity. In particular, L161982, a selective EP4 receptor antagonist, turned down the TRPV1 current and decreased the neuronal excitability of DRG neurons to reduce spinal pain.
All animal experiments in this study were approved by the Local Committee of Animal Use and Protection of the Third Hospital of Hebei Medical University (Hebei, China). The C57BL/6J male mice were obtained from Shanghai SLAC Laboratory Animal Co. Ltd. (Shanghai, China). We anesthetized the 2-month-old mice with ketamine (at a dosage of 100 mg/kg) and xylazine (at a dosage of 10 mg/kg). For the spinous processes, supraspinous and interspinous ligaments of L3-L5 vertebrae were resected to create the LSI model that led to vertebral endplate degeneration. Correspondingly, the posterior paravertebral muscles of L3-L5 vertebrae were detached in the sham group. At 8 weeks after operation, LSI mice received vehicle or L161982 (5 mg/kg/d) (Tocris, U.S.) by intraperitoneal injection for 2 weeks. To overactivate the TRPV1 channel, LSI mice received capsaicin injection at caudal endplates of L4–L5. Specifically, 2
Mice were euthanized by isoflurane and perfused by 10% buffered formalin. The L3-L5 lumbar spine was collected and examined by
The lumbar spine or DRG samples were dissected from mice and then were fixed in 10% buffered formalin (4°C, 24 h). The samples of the lumber spine were decalcified by 0.5 M ethylenediamine tetraacetic acid at 4°C for 3 weeks, and the L2 DRGs were dehydrated by 30% sucrose at 4°C for 48 h. The spine samples were embedded in optimal cutting temperature compound (OCT) or paraffin. The DRG samples were embedded in OCT. We used the 4
Pressure tolerance was measured by the vocalization thresholds (as a nociceptive threshold) using a force gauge (Bioseb). Animals were gently restrained and received the pressure force by a sensor on their skin over the L4-L5 spine. A gradual increase in pressure force (50 g/s) was performed on the mice until the animals made an audible vocalization. To prevent tissue injury, the maximum force was limited to 500 g.
Spontaneous activity was measured by several indicators (including distance traveled, active time, and maximum speed) using the activity wheels (Bioseb). Animals were kept in the cages which are similar to their home cages, and the wheels of the device could be rotated by animals in both directions. The software of this device could record the real-time data of the animals’ spontaneous activity.
The pain hypersensitivity in response to mechanical stimulation was measured by hind paw withdrawal frequency (PWF) using the von Frey test with 0.07 or 0.4 g filament (Stoelting). Animals were restrained in a transparent plastic cage, which was put on a metal mesh grid. The midplantar position of the animal’s hind paw was stimulated by 0.07 or 0.4 g filament through the mesh grid. The filaments should be buckled by enough pressure, and the frequency of mechanical stimulus was 10 times at a 1 s interval. When the hind paw was withdrawn after the stimulation by von Frey filaments, it was recorded.
The total RNA of the L4-L5 caudal endplate was extracted by using the TRIzol reagent (Tiangen, Beijing, China). We measured RNA purity by the absorbance of 260/280 nm. With the RevertAid™ First Strand cDNA Synthesis Kit (Thermo Fisher, U.S.), we reverse transcribed 1
The primer sequence for qRT-PCR.
Target gene | Forward primer | Reverse primer |
---|---|---|
COX2 | CAGACAACATAAACTGCGCCTT | GATACACCTCTCCACCAATGACC |
PGES | TTTCTGCTCTGCAGCACACT | GATTGTCTCCATGTCGTTGC |
EP1 | GACGATTCCGAAAGACCGCAG | CAACACCACCAACACCAGCAG |
EP2 | GATGGCAGAGGAGACGGAC | ACTGGCACTGGACTGGGTAGA |
EP3 | TGCTGGCTCTGGTGGTGAC | ACTCCTTCTCCTTTCCCATCTGTG |
EP4 | CTGGTGGTGCTCATCTGCTC | AGGTGGTGTCTGCTTGGGTC |
GAPDH | AATGTGTCCGTCGTGGATCTGA | AGTGTAGCCCAAGATGCCCTTC |
The PGE2 Parameter Assay Kit purchased from R&D Systems (U.S.) was used to measure PGE2 concentrations in the L4-L5 endplates.
We extracted the total protein of the L4-L5 caudal endplate by using RIPA lysis buffer (Beyotime, Shanghai, China). With 12% SDS-polyacrylamide gel electrophoresis, 20
As previously described, we selected the small-diameter neurons (
Pipettes (3-4 M
The pipette solution contained the following (in mM): KCl 140, EGTA 0.5, HEPES 5, and Mg-ATP 3 (pH 7.3 with KOH). The bath solution for DRG neurons was as follows (in mM): NaCl 140, KCl 3, MgCl2 2, CaCl2 2, and HEPES 10 (pH 7.3 with NaOH). Cells were examined for action potential firing with a series of 1 s current from 50 pA to 500 pA in 50 pA increments or with a liner ramp of current from 0 pA to 1000 pA (500 ms duration). -200 pA (200 ms) was injected to measure membrane input resistance (
We conducted data analyses by using SPSS15.0 software. Data were shown as
To demonstrate the endplate porosity in LSI mice, we examined the L4-L5 caudal endplates after 4 and 8 weeks of surgery using histological staining and 3-dimensional
Sensory innervation in the porous endplate in LSI mice. (a) Representative images of safranin O and fast green staining of the proteoglycan (red) and bone marrow cavities (green) in the L4-L5 caudal endplates (coronal view) in the LSI or sham group. (b) Representative images of
Immunofluorescent staining showed the innervation of CGRP+ nerve fibers in the porous endplate at 4 and 8 weeks after LSI surgery, but the CGRP+ nerve endings did not exist in homogenous endplates of sham surgery mice (Figures
In the behavior test experiments, the vocalization threshold was recorded as an indicator of pressure tolerance. We found that LSI surgery significantly decreased the pressure tolerance at 4 and 8 weeks, as compared with the sham surgery mice (Figure
Spinal hypersensitivity increased in LSI mice. (a) Pressure tolerance was determined by a vocalization threshold in the LSI or sham group. (b–d) Voluntary and spontaneous activity was evaluated by three indicators including (b) distance traveled, (c) active time per 24 h, and (d) maximum speed of movement. (e, f) The PWF in response to the von Frey test in the LSI or sham group.
We further examined LSI surgery effects on animals’ voluntary and spontaneous activity, including distance traveled, active time per 24 h, and maximum speed of movement. All three indicators decreased significantly in LSI mice rather than in the sham group at 4 and 8 weeks (Figures
Finally, we performed the von Frey test to evaluate the mechanical hypersensitivity of the hind paw, which could indirectly reflect the severity of LBP. The PWF was increased significantly by LSI surgery at 4 and 8 weeks (Figures
Since PGE2 is the cyclooxygenase 2 (COX2) product in the inflammatory environment, we examined COX2 expression, prostaglandin E synthase (PGES) expression, and PGE2 concentration in L4-L5 endplates at 8 weeks in the two groups. qRT-PCR and immunostaining showed an increase in COX-2 expression at 8 weeks in the LSI group relative to the sham group (Figures
PGE2 concentration and EP4 expression increased in the porous endplate of LSI mice. (a) qRT-PCR analysis of COX-2 expression in L4-L5 caudal endplates in the LSI or sham group at 8 weeks. (b) Representative images of immunostaining of COX-2 (green) and DAPI (blue) in the L4-L5 caudal endplates in the LSI or sham group at 8 weeks. (c) Quantitative analysis of the percentage of COX-2+ area in endplates. (d) PGES expression by qRT-PCR in L4-L5 caudal endplates in the LSI or sham group at 8 weeks after surgery. (e) PGE2 concentration determined by ELISA analysis in L4-L5 caudal endplates in the LSI or sham group. (f) qRT-PCR analysis of EP1, EP2, EP3, and EP4 expression in L4-L5 caudal endplates in the LSI or sham group at 8 weeks after surgery. Scale bars, 50
Since there were four types of EP receptors (EP1-EP4) mediating PGE2’s functions, we used qRT-PCR to evaluate the change of the mRNA levels of these four types of EP receptors after LSI surgery. Interestingly, we found a 6-fold increase in EP4 expression and a 2-fold increase in EP2 expression in the LSI group relative to the sham group by qRT-PCR. But there was no significant difference in EP1 and EP3 expression between the LSI and sham groups (Figure
Immunofluorescent staining showed that EP4 expression existed in CGRP+ nerve fibers in degenerative endplates (Figure
EP4 and TRPV1 expressed in CGRP+ nerves and in CGRP+ DRG neurons of LSI mice, respectively. (a) Representative images of the coimmunostaining of CGRP and EP4 in L4-L5 caudal endplates in the LSI or sham group at 8 weeks. (b) Representative images of the coimmunostaining of CGRP and TRPV1 in L4-L5 caudal endplates in the LSI or sham group at 8 weeks. (c) Representative images of the coimmunostaining of CGRP and EP4 in L2 DRGs in the LSI or sham group at 8 weeks. (d) The percentage of the EP4+CGRP+ area relative to the CGRP+ area in the LSI or sham group. (e) Representative images of the coimmunostaining of CGRP and TRPV1 in L2 DRGs in the LSI or sham group at 8 weeks. (f) The percentage of the TRPV1+CGRP+ area relative to the CGRP+ area in the LSI or sham group. Scale bars, 50
In a previous study, a retrograde tracing experiment was conducted in LSI mice. They found that Dil was significantly retrograded to L1-L2 DRG, especially to L2 DRG [
Western blotting analysis showed that EP4 and TRPV1 expression increased in L2 DRG in LSI mice compared with the sham group (Figures
LSI surgery increased TRPV1 expression and TRPV1 channel current density in L2 DRG neurons. (a) Representative images of western blotting of EP4 and TRPV1 expression in L2 DRGs in the LSI or sham group at 8 weeks after surgery. (b) Quantitative analysis of EP4 and TRPV1 expression in L2 DRGs in the LSI or sham group at 8 weeks after surgery (
L2 DRG neurons were isolated from the mice at 8 weeks and then were cultured overnight. With the whole-cell patch clamp, we did the electrophysiological experiments in small-size neurons (
We used L161982, an EP4-receptor antagonist, to investigate the effects of blocking PGE2/EP4 signaling on spinal hypersensitivity. In pressure tolerance and spontaneous activity tests, L161982 treatment increased pressure tolerance and spontaneous activity of LSI mice compared to the vehicle group (Figures
L161982 reduced spinal hypersensitivity of LSI mice. (a) Pressure tolerance was determined by a vocalization threshold at 2 weeks after L161982 or vehicle treatment. (b–d) Voluntary and spontaneous activity was evaluated by three indicators including (b) distance traveled, (c) active time per 24 h, and (d) maximum speed of movement. (e, f) The PWF in response to the von Frey test (0.07 g or 0.4 g) at 2 weeks after L161982 or vehicle treatment.
Similarly, the inhibitory effect of L161982 on hind paw mechanical hypersensitivity, as indicated by decreased PWF to 0.07 g or 0.4 g stimulation, was also demonstrated at 2 weeks after treatment (Figures
However, the EP4 receptor antagonist L161982 did not influence the endplate porosity of LSI mice (Supplementary Figure
Moreover, we injected capsaicin at the caudal endplate of L4-L5 of LSI mice to overactivate the TRPV1 channel. We found that TRPV1 overactivation increased spinal hypersensitivity based on the behavior test results. And the spinal hypersensitivity was obviously increased in the LSI+capsaicin+L161982 group, compared with the LSI+L161982 group (Supplementary Figure
Western blotting analysis showed that EP4 and TRPV1 expression decreased in L2 DRG of mice with L161982 treatment relative to vehicle treatment (Figures
L161982 reduced TRPV1 expression and TRPV1 channel current density in L2 DRG neurons of LSI mice. (a) Representative images of western blotting of EP4 and TRPV1 expression in L2 DRGs at 2 weeks in the sham+vehicle, LSI+vehicle, and LSI+L161982 group. (b) Quantitative analysis of EP4 and TRPV1 expression in L2 DRGs at 2 weeks in the sham+vehicle, LSI+vehicle, and LSI+L161982 group (
The TRPV1 current amplitude (1
In addition, the capsaicin-responsive neuron percentage decreased in the L161982 group compared to the vehicle group (Figure
We found that TRPV1 overactivation by capsaicin injection increased TRPV1 current measured with a patch clamp. And the TRPV1 current was obviously increased in the LSI+capsaicin+L161982 group, compared with the LSI+L161982 group (Supplementary Figure
To determine whether LSI surgery increases DRG neuronal excitability and whether PGE2/EP4/TRPV1 pathway activation is responsible for DRG neuron hyperexcitability of LSI mice, evoked action potentials (APs) were studied by current clamp recording.
With step current injection, LSI surgery increased AP firing frequency compared to the sham group, and the AP firing frequency could be reduced by L161982 treatment (Figures
L161982 treatment attenuated LSI-induced increase in neuronal excitability. (a) AP firing traces in L2 DRG neurons to 1 s, 300 pA depolarizing current injection. (b) Quantitative analysis of APs induced by step current injection in the sham+vehicle, LSI+vehicle, and LSI+L161982 groups. (c) Current threshold for APs in the sham+vehicle, LSI+vehicle, and LSI+L161982 groups (
Summary of current clamp properties of DRG neurons.
Current clamp properties | Sham+vehicle | LSI+vehicle | LSI+L161982 | ||||||
---|---|---|---|---|---|---|---|---|---|
Mean | SD | Mean | SD | Mean | SD | ||||
Input resistance (M | 520.91 | 154.55 | 20 | 521.60 | 153.04 | 20 | 497.21 | 172.56 | 20 |
Capacitance (pF) | 22.32 | 4.88 | 20 | 22.46 | 4.92 | 20 | 23.50 | 3.96 | 20 |
RMP (mV) | -59.00 | 7.57 | 20 | -58.50 | 6.64 | 20 | -58.65 | 7.39 | 20 |
AP amplitude (mV) | 112.90 | 9.94 | 20 | 114.43 | 10.03 | 20 | 113.20 | 6.60 | 20 |
Threshold (pA, ramp protocol) | 470.00 | 134.54 | 14 | 204.26 | 81.77 | 19 | 351.38 | 71.45 | 16 |
In addition, we evaluated the neuronal hyperexcitability by ramp current stimulation. LSI surgery significantly increased the firing of APs relative to the sham group, and the firing of APs was lowered by L161982 treatment (Figures
The IVD degeneration is regarded as one of the most common diseases causing LBP [
Consistent with the previous study [
In our study, we found that COX2 expression and PGE2 concentration were significantly increased in the porous endplate in LSI mice. Moreover, there was a 6-fold increase in EP4 expression and a 2-fold increase in EP2 expression in the endplate of LSI mice relative to sham mice, but there was no significant difference in EP1 and EP3 expression between the two groups. Thus, the PGE2/EP4 pathway might play a crucial role in spinal hypersensitivity of this animal model. When tissue was damaged, the inflammatory mediators, such as PGE2, were released at the local region or in the spinal cord [
The crucial role of TRPV1 activation in spinal pain of LSI mice was also demonstrated in our present study. We found a higher expression of TRPV1 in L2 DRG which innervated in L4-L5 endplates of LSI mice. The upregulated expression of TRPV1 in L2 DRG correlated well with the increase in spinal hypersensitivity. Furthermore, the patch clamp results showed that LSI operation increased TRPV1 current density, suggesting that the functional TRPV1 expression was increased by LSI surgery. Thus, the increased current density of the TRPV1 channel might participate in LSI-induced spinal hypersensitivity.
TRPV1, a member of TRP ion channels, has been recognized as “a molecular gateway” to nociceptive sensation. TRPV1 was mainly distributed in the dorsal root ganglion, trigeminal ganglion, spinal cord, and peripheral nerve endings. In addition, TRPV1 was also found in some nonneural tissues such as the lung, gastrointestinal tract, and respiratory tract. In recent years, it has been found that TRPV1 is important in mediating hypersensitivity mediated by inflammation nocuous chemical, mechanical, or thermal stimuli in the airway, skin, gastrointestinal tract, and other organs [
TRPV1 contributes to spinal hypersensitivity. Evidence proved that hypersensitivity induced by activation of spinal cord PAR2 receptors is mediated by TRPV1 receptors [
Actually, there is a close relationship between the PGE2/EP4 pathway and TRPV1 channel. PGE2 has been shown to increase surface trafficking of EP4 and TRPV1 in vitro [
PGE2 acts on target cells through its receptors EP1, EP2, EP3, and EP4. Interactions of PGE2/EP4 and TRPV1 in pain hypersensitivity have been proven. PGE2 enhanced capsaicin-induced currents in DRG neurons through EP4 [
In our study, we showed that L2 DRG neurons exhibited an increased excitability in the LSI model. The hyperexcitability of DRG neurons was decreased by the inhibition of the PEG2/EP4 pathway with L161982. These results showed that TRPV1 channel activated by the PEG2/EP4 pathway participated in the enhancement of the excitability of DRG neurons in LSI mice. It has been reported that the hyperexcitability of DRG neurons leads to central sensitization and chronic pain [
In conclusion, the PGE2/EP4 pathway in the porous endplate could activate the TRPV1 channel in DRG neurons to cause spinal hypersensitivity in LSI mice. L161982, a selective EP4 receptor antagonist, could turn down the TRPV1 current and decrease the neuronal excitability in DRG neurons to reduce spinal pain.
The data used to support the findings of this study are available from the corresponding author upon request.
The authors declare that they have no conflicts of interest.
Sijing Liu, Qiong Wang, and Ziyi Li contributed equally to the work.
This study was supported by the Basic Research Program for Beijing-Tianjin-Hebei Coordination (No. 19JCZDJC65500[Z]), Osteoporosis Program for Young Doctors (No. GX20191107), Government Foundation to Train Clinical Talents and Leading Specialists (No. 361005), Medical Application Technology Program of Hebei Province (No. G2019008), Tianjin Outstanding Youth Fund Project (No. 20JCJQIC00230), and National Natural Science Foundation of China (No. 81971660).
Supplementary Figure 1: the effects of LSI treatment on vertebra bone mass and L161982 treatment on endplate porosity. (A) Representative three-dimensional high-resolution