The present study is aimed at optimizing the in vitro culture protocol for generation of rat bone marrow- (BM-) derived mesenchymal stem cells (MSCs) and characterizing the culture-mediated cellular senescence. The initial phase of generation and characterization was conducted using the adherent cells from Sprague Dawley (SD) rat’s BM via morphological analysis, growth kinetics, colony forming unit capacity, immunophenotyping, and mesodermal lineage differentiation. Mesenchymal stem cells were successfully generated and characterized as delineated by the expressions of CD90.1, CD44H, CD29, and CD71 and lack of CD11b/c and CD45 markers. Upon induction, rBM-MSCs differentiated into osteocytes and adipocytes and expressed osteocytes and adipocytes genes. However, a decline in cell growth was observed at passage 4 onwards and it was further deciphered through apoptosis, cell cycle, and senescence assays. Despite the enhanced cell viability at later passages (P4-5), the expression of senescence marker,
Mesenchymal stem cells (MSCs) were originally isolated by Friedenstein and colleagues in guinea pig’s bone marrow [
It is now recognized that MSCs reside in many tissues and organs other than bone marrow [
Many types of research that test the in vivo nature or functions of MSCs are still remarkably relying on animal models. Employing animals in biological science has become indispensable as most of the pharmacological and toxicological studies have been developed using laboratory-based animals as testing tools. For instance, the convenience of mice model with a possible genetic modification and availability of research reagents and species-specific antibodies ease the preclinical studies [
Sprague Dawley (SD) rats (250–350 g and 5–8 weeks) were obtained from Chenur Supplier (Kajang, Selangor, Malaysia). Animals were acclimatized and handled with standard animal care procedures as prescribed by Institutional Animal Care and Use Committee, Universiti Putra Malaysia (IACUC, UPM). Animals were sacrificed by cervical dislocation.
Bone marrow cells were obtained from Sprague Dawley (SD) rats by flushing femurs and tibiae and cultured in 25 cm2 flask in a complete culture medium with 1% penicillin/streptomycin, 0.5% Fungizone, and 0.1% gentamycin (Gibco, United Kingdom). After 72 hours of plating, nonadherent cells were removed, and medium was replaced at every 48 hours. Adherent cells were further propagated and upon reaching 80–90% confluency, cells were trypsinised by using 0.05% trypsin-EDTA (Gibco, United Kingdom) at 37°C for 3–5 minutes. Harvested cells were cultured in 25 cm2 flasks for further expansion. During expansion period, media were changed every 2 days. Expanded cells were either used for downstream experiments or cryopreserved using freezing media (10% DMSO and 90% FBS). Media used in rBM-MSC expansion were LDMEM with GLUTAMAX-I (Gibco, United Kingdom), supplemented with 20% foetal bovine serum (FBS), 1% penicillin/streptomycin, 0.5% Fungizone, and 0.1% gentamycin (Gibco, United Kingdom). Supplements used in the optimization were 20 ng/mL basic fibroblast growth factor (bFGF) (R&D System USA), 1% nonessential amino acids (NEAA) (Gibco, United Kingdom), and 1% insulin transferrin sodium selenite (ITS) (Sigma Aldrich, USA).
Colony forming unit-fibroblast (CFU-f) assay was conducted with 1 × 106 of nucleated cells from freshly isolated rat bone marrow and seeded in 60 mm2 cell culture dish (Becton Dickinson, USA) for 10 days. Various basal media were consumed to assess CFU-f as presented in Table
Basal media and FBS concentration used for CFU-f assay.
Basal media | FBS concentration (%) |
---|---|
Roswell Park Memorial Institute (RPMI) with GLUTAMAX-I | 10 |
RPMI with GLUTAMAX-I | 20 |
Dulbecco’s Modified Eagle’s Medium with nutrient mixture F12 (HAM) [1 : 1] DMEM/F12) with GLUTAMAX-I | 10 |
DMEM/F12 with GLUTAMAX-I | 20 |
Low glucose Dulbecco’s Modified Eagle’s Medium (LDMEM) with GLUTAMAX-I | 10 |
LDMEM with GLUTAMAX-I | 20 |
High glucose Dulbecco’s Modified Eagle Medium (HDMEM) with GLUTAMAX-I | 10 |
HDMEM with GLUTAMAX-I | 20 |
The expression of cell surface markers was measured by a direct immunofluorescence staining and analysed by flow cytometer. Cells at passages 2-3 were trypsinised and cell count was performed using trypan blue exclusion test. Upon staining, cells were transferred into Fluorescence Activated Cell Sorting (FACS) tubes and washed with 1x phosphate buffer saline (1xPBS). Cells were labelled with fluorochrome conjugated mouse anti-rat antibodies (CD90.1-PE, CD45-PE, CD11B/C-PE, CD29-FITC, CD71-FITC, and CD44H-FITC) for 15 minutes at 4°C. For analysis, 10,000 cells were acquired by LSR Fortessa flow cytometer (BD Biosciences, USA) and analysed using FACS Diva Software (BD Biosciences, USA).
The adipocyte and osteogenic differentiation capabilities of passages 2-3 expanded rBM-MSCs were performed using StemPro adipogenesis differentiation kit (Gibco, Invitrogen, USA) and StemPro osteogenesis differentiation kit (Gibco, Invitrogen, USA), respectively, with minor modifications. Rat bone marrow mesenchymal stem cells were cultured in 60 mm2 Petri dish and incubated at 37°C in 5% CO2 humidified air. Upon reaching 100% confluency, cells were supplemented with respective differentiation medium where the inductive medium was changed every 2 days for 20 days. For adipogenic induction, cells were fixed in 4% paraformaldehyde and stained with Oil Red O solution whereas for osteogenic differentiation, cells were fixed in iced cold 70% ethanol and stained with Alizarin Red solution.
Cellular differentiation of rBM-MSCs towards mesodermal lineages was further confirmed with gene expression assay using RT-PCR. Total RNA of cells that were cultured in either normal medium or induction media (adipo and osteo) retrieved using TRIzol reagent kit (Invitrogen, USA). DNase treatment was carried out by adding 20.5
Primer sequence for adipocyte and osteocytes.
Primer | 5′-3′ | Sequence | Amplicon size | Annealing temperature (°C) |
---|---|---|---|---|
GAPDH | Forward |
TGAACGGGAAGCTCACTGG |
360 | 48.1 |
Osteopontin | Forward |
CCGATGAATCTGATGAGTCCTT |
303 | 57.8 |
Osteonectin | Forward |
ATGAGGGCCTGGATCTTCTTTCTC |
372 | 60.5 |
PPAR |
Forward |
GCCTTGCTGTGGGGATGTCT |
354 | 47.3 |
C/EBPA | Forward |
GCAGAAGGTGTTGGAGTTGA |
214 | 66.7 |
PCR gene amplification conditions for GAPDH, osteopontin, osteonectin, PPAR
Process | Temperature (°C) | Time | Cycle |
---|---|---|---|
Predenaturation | 95 | 3 min | 1 |
Denaturation | 95 | 30 sec | 35 |
Annealing | 1 min | 35 | |
GAPDH | 48.1 | ||
Osteopontin | 57.8 | ||
Osteonectin | 60.5 | ||
PPAR |
47.3 | ||
C/EBPA | 66.7 | ||
Elongation | 72 | 1 min | 35 |
Final elongation | 72 | 10 min | 1 |
Incubation | 10 | ∞ | ∞ |
The proliferation of rBM-MSCs was determined by tritiated thymidine (3H-TdR) assay (Perkin Elmer, USA). The radioactive nucleotide 3H-TdR integrates only into actively proliferating cells during DNA synthesis, and the amount of 3H-TdR measured is directly proportional to the cell proliferation. Five thousand cells per well were cultured in 96-well plate for 24 h, 48 h, and 72 h. Cultures were pulsed with 10
Growth kinetic of rBM-MSCs was performed using trypan blue exclusion test. Approximately, 150,000 cells were plated into 6-well plate. Cells were grown for 6 days with medium change which was performed at every 3 days. Cells were harvested every day and counted. Growth kinetic curves of rBM-MSCs from different passages were plotted. The initial seeding number, days in culture, and yield of MSC cultures were recorded and computed into doubling time. Doubling time was determined by Patterson Formula 1 and expressed as mean doubling time:
Apoptosis assay was performed using Annexin V/Dead Cell Apoptosis kit with FITC conjugated Annexin V and PI (Invitrogen, USA). Annexin V is Ca2+-dependent phospholipid binding protein that binds to phospholipid such as phosphatidylserine (PS). Annexin V along with propidium iodide (PI) allows identification of early apoptotic cells (PI negative; FITC Annexin V positive). Viable cells with intact membranes exclude PI, whereas membranes of dead and damage cells are permeable to PI [
Acid
Cell cycle analysis of rBM-MSC was determined by measuring DNA content using PI dye. Cells at passage 2 and passage 5 were cultured in 25 cm2 flasks. Upon reaching 80–90% confluency, cells were harvested and fixed with 70% ethanol and subjected to overnight incubation at −20°C. Fixed cells were washed with 1xPBS and incubated with 0.5 mL staining buffer which consisted of 100
Values for all measurements were presented as mean ± SD unless otherwise stated. Comparison was performed by Student’s
Upon in vitro culture, single cells of rat BM have started to form adherent cell colonies from day 3 onwards. The colony of spindle-shaped cells has profoundly increased in size at day 5 and day 7 (Figure
Generation and optimization of rBM-MSCs culture. Bone marrow was harvested from femur and tibia of SD rats and nucleated cells were cultured in T25 flask in day 0. By day 3, cells began to attach and heterogeneous population with predominant fibroblast-like morphology were observed by day 7 (a). One million of nucleated cells from bone marrow were cultured for 10 days in respective media and FBS concentrations. Colonies were subjected to crystal violet staining and colonies which brightly stained were counted (b). Four different basal media with 10% and 20% FBS concentration were utilized to culture 1 × 106 freshly isolated BM nucleated cells for CFU and proliferation assays. CFU-f and proliferation assays were measured using crystal violet staining and trypan blue exclusion test, respectively. Results were representative of three independent experiments.
To analyse the expression of cell surface markers on rBM-MSCs, cells at passage 3 were subjected to the immunophenotyping. Flow cytometry result showed that rBM-MSCs are unequivocally positive for CD90.1 (94.8%), CD44H (41.6%), CD29 (99.7%), and CD71 (12.7%) and negative for hematopoietic markers CD45 (4.0%) and CD11b/c (4.3%) as shown in Figure
Characterization of rBM-MSCs. The immunophenotyping to characterize the surface markers was performed using rBM-MSC from passage 3. Cells were positively expressed as CD90.1, CD29, CD71, and CD44 and negatively expressed as CD11b/c and CD45 (a). Mesodermal differentiation was conducted using cells of passage 3 that is subjected to the relevant induction media. After 20 days of induction, cells were stained with Oil Red O solution and Alizarin Red solution, respectively. Adipogenic differentiation was evidence by lipid droplet formation stained with Oil Red O whereas osteogenic differentiation was evidenced by calcium deposits stained with Alizarin Red (b). Gene expression of differentiated adipocytes and osteocytes was evaluated using RT-PCR. Untreated rBM-MSC (control) showed faint expression for osteocytes (c). Results were representative of 3 experiments. OP: osteopontin, ON: osteonectin, PP: PPAR
The growth pattern of rBM-MSCs was tracked by the morphological assessment, growth kinetics curve, and doubling time at various passages. The morphology of adherent cells appeared to be relatively smaller and defined at passage 1 till passage 3 (Figure
Growth kinetics and doubling time of rBM-MSC. Morphological observation of rBM-MSC cultured in LDMEM (20% FBS) in the presence of 20 ng/mL, 1% ITS, and 1% NEAA at various passages. Cells were successfully expanded until passage 5 and assumed a spindle-shaped fibroblast-like morphology. As the passage increased, polygonal and flatten shaped cells were predominating (a). Rat BM-MSCs were plated in 6-well plate at 150,000 cells/well, and media were changed every 2 days for 6 days. Cells depicted an initial lag phase for 1 day, followed by exponential log phase for 4 days, and then a plateau phase was observed (b). Doubling time was determined by Patterson Formula
Since rBM-MSCs from passages 1–5 exhibited various growth kinetic patterns with compromised log phases at late passages, another mean of measurement was opted to verify this phenomenon. The proliferation rate of rBM-MSCs was further rectified using tritiated thymidine (3H-Tdr) incorporation assay. The highest proliferation was observed at 48 hours in all passages. However, the active proliferation was only noted at passages 1–3 while cell expansion was halted at passages 4-5 (Figure
Cellular senescence and cell cycle arrest of culture expanded rBM-MSCs. Cells from passages 1–5 were seeded at 5000 cells/well cultured in 96-well plate for 24 h, 48 h, and 72 h. Cultures were pulsed with 10
Apoptosis assay was performed to assess the viability of rBM-MSCs at various passages (P1-P0) whether the documented cellular senescence is caused by the induction of apoptosis. The apoptosis results revealed that as the passage was increased the percentage of early apoptosis decreased while the percentage of viability is increased as shown in Table
Percentage of viability and early apoptosis at various passages of rBM-MSC.
Passage | Viable cells (%) | Early apoptosis (%) |
---|---|---|
1 |
|
|
2 |
|
|
3 |
|
|
4 |
|
|
5 |
|
|
Various studies have been conducted using animal models in attempt to evaluate the potential use of MSCs in clinical applications. As preclinical study is vital for clinical trials, this requires an establishment of animal-based MSCs culture system through a feasible isolation and expansion procedure at in vitro setting [
The initial primary culture (P0) of BM was mixed with other cell populations which did not allow a clear discrimination between MSCs and other adherent cells. However, as the number of passages was increasing, the adherent cell culture became more morphologically homogenous. Along with MSCs, BM cultures at passage 0 were also found to be comprised of other primary BM cells such as macrophages and endothelial cells that promote heterogeneity of primary culture. Since the present study has utilized a whole BM, the contamination of other BM residing cells, namely, hematopoietic cells, fat cells, endothelial cells, and fibroblasts that may retain up to fewer passages of BM culture, could contribute to formation of mixed populations [
To date, there is no standard method for culturing rBM-MSCs. It is difficult to compare methods of culturing MSCs as there are high inconsistency among different laboratories such as choice of media, the type of serum, plating density, the addition of supplements, and level of confluency which play a crucial role in MSCs culture as it can affect the expansion, differentiation, and immunogenic properties of MSCs [
High glucose DMEM and DMEM/f12 are among commonly used media for culturing adherent cells especially MSCs while RPMI are routinely used for culturing lymphocytes [
Although the colonies formed in LDMEM culture medium are highest, further cultivation in the same medium with 20% FBS did not support the expansion of rBM-MSCs. This phenomenon is also observed in other basal media and thus prompted us to use additional growth factors. Basic FGF was used to enhance the growth of rBM-MSCs in our study as it is the most common growth factor that is known to induce proliferation of MSCs [
Mesenchymal stem cells characterization mainly relies on the assessment of (1) surface antigen markers expression and (2) the ability of MSC to differentiate into mesodermal lineages (osteocytes, adipocytes, and chondrocytes). To date, there are no specific markers for MSCs; thus a combination of commonly accepted positive and negative markers was opted for the MSC's immunophenotyping. We have shown that rBM-MSCs were positive for CD29, CD90.1, CD44H, and CD71 and negative for hematopoietic markers CD45 and CD11b/c [
To determine the proliferative capacity of rBM-MSCs, tritiated thymidine (3H-TdR) and growth kinetic assays were performed. Rat BM-MSCs were spotted to proliferate rapidly at passage 1 until passage 3 while reduction in proliferation was evidenced at passage 3 onwards and almost ceased at passage 5. These results were further confirmed with 3H-TdR assay and deduced doubling time. Cells at passages 1–3 had maintained a stable doubling time (30 hrs); however, the doubling time was started to upraise at passage 4 (50 hrs) and reached maximum at passage 5 (130 hrs). However, the cells were unable to be further expanded beyond passage 5 due to the complete halt in cell growth despite the use of optimized culture medium. This observation is not a new phenomenon as Liu et al. (2003) also reported a similar finding that rBM-MSCs from Wister rats were only being cultured till 4 successful passages [
The ceased proliferation of passage 5 rBM-MSCs has triggered the need for further exploration of the possibility of apoptosis or senescence. The apoptosis result was not in agreement with the spotted growth arrest of passage 4-5 cells. Surprisingly, the viability of cells was improved with the number of passages. However, a substantial fraction of cells at all passages was undergoing early apoptosis process but not late apoptosis as shown in Table
Our data also revealed that rBM-MSCs almost cease to proliferate at passage 5 and morphology of cells was large and flattened which are characteristics of cellular senescence.
The hallmark of senescence is the inability of cells to advance into cell cycle. Senescence cells show growth arrest at G1 phase of cell cycle, despite sufficient growth condition, cells still fail to initiate DNA replication [
Study on human fibroblasts demonstrated that, under an inadequate culture condition (0.25% FBS), the cells underwent a premature growth arrest. When fibroblasts were initially expanded in 10% FBS and later grown in 0.25% FBS, they showed a substantial arrest in cellular growth. However, the cell growth recovered and cell cycle machinery was activated when the culture was reconstituted with 10% FBS. In fact, transfection of HTERT (human telomerase reverse transcriptase) as well did not abolish the growth retardation in the presence of 0.25% of FBS [
In conclusion, the present study has successfully generated and characterized the rBM-MSCs from SD rats with optimized culture conditions based on the choice of basal medium, concentration of FBS, and growth factor supplements. The basal media LDMEM and 20% FBS provide the optimal culture condition for expanding rBM-MSC and the addition of bFGF, ITS, and NEAA significantly enhanced the morphology and proliferation capacity of rBM-MSCs at very early passages. Under the in vitro culture condition, even with optimized culture conditions, rBM-MSCs were undergoing cellular senescence which may relate to the gradual autocommitment of rBM-MSC into mature cells. Thus, further research is necessary to understand the internal and external cues that trigger the process of senescence in culture expanded rBM-MSCs.
The authors declare that there are no competing interests regarding the publication of this paper and regarding the funding that they have received.
This research work is supported by Fundamental Research Grant Scheme (FRGS), 04-01-12-1131FR, and Research University Grant Scheme (RUGS) 04-02-12-1757RU.